Description :
From Genome Similarity Track
Location :
contig_187:25572- 27162
Transcript NameFunction/comments
g14664.t1hypothetical protein

Sequence
1590 bases(100 bases per row)
GTACACTCCGCGACAAGATAAATCACCCACCCTCGTTTGAGGCACAGCTCTGTCAATATTACGAGTTAGCTATTGCTGTTTAGATATGCTGCTTCTGTCA
CCAATAGACAACGTGTTTGTGCTAACGATTGCAATTTCGCCGCGTGCGGGGGACCTCCAATACAAAATTCCATTTAAGCATAGCGACACATTAGATCACC
CACTCGAAGCGTACAAAAATCAAGTATAAAAGAATGACGGTAATTTCAATAGTGCGTCTTATGCCTTTCTTATCTAAGACTTCGATGCATCTGCGTGGCA
TGGAGTCAATGAGGGACATCAGCAGTGCATGAGGAATGGATTCCCAAGCCGCAAACAATGCAGCCCAATTGAGGCACCCTATCAAATTGTCTTCCATTTG
CATACACTCGCCTACTCATAATGGACCACAAATTCTCAATAGGATTGAGAACTGGGGATTTTGATGGCCAGTCGAGCAAGCGAATATCTTTCTCAGAGAA
AAACTCCTTGGTGCGCTTTGATGCGTGGATGCTTGCATTGTCTTGCTGGAAGATAATCGATACCGTAGTTTAGATGAGCAAGGGGAGGAGATACTCGGAG
ACAGTGACGTAGTCATCCGAGTTCTGCCTCCCCGTAAGAATCACTAGAGGCGCCTTACCACGCGAGCTGAAGCCAGCCCAAACCATGACAGATCCGCCAC
CAGCCTGGCGCCTCTTGGTCTGGCGGGGTGGCTTGCGCAGGTCTCGCCAATAGTGCTGGAAGCCATCGGGTCCATCCAGGTTCCACTTCTTCTCATCAGA
GAAGGTAATGGAGTTACAGATGACCCCGGTGTCCTTGCACAGTAGCATGGCGCTGGCCCACGCTTTGCGTTTCAGCATGTCCTCGGGCTTGAGGGGAGCG
TGTTCACCATCTTGGTGTACACCAACCAGCCACCCTTGCTAGGGTGCGCTGGATGGTGCGCACTGAAACGGTGAGCTGGAGCTCCGTCTTGAGCTGGGCA
GCCGACAACATGCTCTTGGCAGCAGCGCGGATGAGACGGCGGGTCTCGCGGTCAGAGAATGCCGGGGCAGGCCCAGGTCGCTTGGCTTCTTGGTGTGGCG
GTGTAGGCGTCGTGACGCGTCTGATGGTGTGTGTGCATCGCCCTGTGCTCTTCGCAACAGTACGGGTGCTCAGCCCAGCTTCTCGTAGCCCTTGGATCCT
GCCCTTTTCGCGCTCGGTCACCCGAGGCTTCTTCTTGCTTGCCTTCTTCATCTTTGGAAAATGATCCGCTCCACTGCACCCAGAGTAGCGATCTCGCAGC
GCCAGTCGCTCAAAATGCCAGTTGCACGCCACTCATTTCCCAAAATTACCGTCATTATTTTATACTTGATTTTTGTACGCTTCGAGTGGGTGATCTAATG
TGTCGCTATGCTTAAATGGAATTTTGTATTGGAGGTCCCCCGCACGCTGCGAAATTGCAATCGTTAGCACAAACCACGTTGGTCTATTGGTGACAGAAGC
AGCATATCTAAACAGCAATAGCTAACTCGTAATATTGACAGAGCTGTGCCCTCAAACGAGGGTGGGTGATTTATCTTGTCGCGGAGTGTA