Description :
From Genome Similarity Track
Location :
Scaffold_600:2557- 3857
Transcript NameFunction/comments
Phyke_g10565hypothetical protein
Phyke_g10566hypothetical protein PHYSODRAFT_310535

Sequence
1300 bases(100 bases per row)
TGCTCATCTTCTCCGCTATCCGCCATGTGGGAGGTACAGCGAGTTCAGCGAAACATTCGGCAGACAATTAAAAAAAAGTAGTGTTAGATACTCATTATTG
GTAGAATGACAGCCAATCTTAACGAAACGGACATGACACCAATACATGAATCCAAACAACGTATCATATGAGTTGCCCATACGATTCTCTTTATGATGGG
GCTTGGTATGGCATGCACAACGTGACTGTATGTAGACCTTTGTCATAACTACTGTACATGCATGCATCTCCACTATAGTCAAGTGACTAGCTGGCTCAAG
GTAGGAGGATCCGCCATACTCGGATACTTTCAAAACAATATTTGACCGAGCCAGTTCTACGACGCAAAAAACAATTGAACAGACCGTCTCGCTGTGAGAC
TTTTACGATGTACAGCGCGTGACAAACTTCAAAAACTCGTGGTAGTACTTGTAGTCAGGGTTGATCTTGAGCGCGCTTTTTAGAGAGACCATTGAGACCC
AACATGTTCTTAACGTACCACTTGGGTTTTCTTGCTGACGTACATGCGCTACGCGAGCAAGTATGATGTTTGGGCGTATTCGTATAGAAACGGCTTTCTC
GGATCTCCGTGATGCACCGGGGAATACTTGGGAGGTTGTCGGTAAAAGCGAAGATGTGGGCTCAACTAAGAAGATTCGAGAGTTACGTTAAAAAAATGGT
CGAGCGTCGTTAGGAGGCGGTTAAGTGCAAGATACATATCAAAGCTGCTTTGGATTTTTGACGAAGAATACATTTGCTTATCGCCTAGCACTCTGTTTAA
TCTACCACATAGCTAAAGGTTTAACATGTAACCTCGACCTTGACATGACATGATGCATGCAATTAATCAGTGAGAGATACACTAATAGTCAATCTACTTG
TTCGCGCTAAATCTCTCGCTCAATGCCCGCGCCGTGACTGCGCTCAATCGGATGTTTTGGTGTGGTAAGCTCCTTGTCAATTGACTTCTCTCCACGACGC
GGGATCATTGCGAActgcatttttttcatcaCGAGGACGAAAAAAATCGTGTTGACTGCCATCAATGCTGCAATCGCGAAGTACAGGTACTCGAAGTGAC
CATCGTTCAGGTTTGCGGGGATGTACTTGCCGAACAACAGTACAATGACCGACAGCAATGTGCTGCCCATtgagttgatgaagaggcCAAGCGCAATGGA
CACACCGCGGAGGCTCATCGGAACTTCTGTATATCCGATGTTGTACGTCGGAATTTGGATGAGAACTGTCGCAGTGGCCACCAACACATACTGGGGAATG