Description :
From Genome Similarity Track
Location :
contig_57:255690- 257223
Transcript NameFunction/comments
g10532.t1POM68382.1 Amino Acid/Auxin Permease (AAAP) Family [Phytophthora palmivora var. palmivora

Sequence
1533 bases(100 bases per row)
CTTCATCACTTCCAATTTGGCTGCCTCCAGCTCAAGCCTCTGATCAACAGCGCGCTCCAATCCTTTGCCGTCCCTGACAACCATGGCTAAGGGCCCTTTC
TTCACCGCGGAGGACGCCAAGTCGGCCTTCAACCTCTTCTGCTGTATCTACGGCGTTGGTACTCTTGGTATGCCCGGCAACTTCTCGCGCGCCGGCCCTT
TCCTCGCTGTTGTCGCCATGGCCTTCATGGCCTTCGCCAACATCTACGCGTCCATGACCATGTCCAAGGTCATGCTGCTCGCGCCCAGGTCCGTCAAGAC
GTTTGGAGACCTCGGTCAGTGGTGCATGGGGCCGATTGGTCGCTGGCTGTGTATCGTCTCGCAAATGGGCTCGTGCCTTCTCCTCCCGTGCGTCTTCCTG
GTCCTCGGCGGTTCGCTGCTGGACGGCCTCTTCCCGGGAGCCTTCAGCCAGACGACGTGGATCATCTTCATGGCGCTCATGGTGCTGCCTGTTTGCTTGG
TGCCCACCCTCAAGGAAGGAGCTGGCGCCGCCTTCGCCGGATGCCTGGGAACGATCATTGCCGACATCATCGGCGTGGCTGTAGTCATACACGGACTCAG
TGGCCACCCGAGCGTGCCGACGCCTGACCTTTCGTTCGAGCAGGTCGCTGGCTGCTTCGGCAACCTGTCGCTCGCCTACGGGGCTGGTATCGTGATCCCG
GACATCCAGCGCCAGCACAGCGACCCCAAGCGCATGCCGCGCGTCGTGGGCGTCACCGTCGGCATCATCTCGATCCTGTTCCTGGTGCTAGCCAGCACCG
CGTACTCGGCCGTGGGATGCCAGATTTCGGGCAACCTGCTCTTCACTATCTACCCGGACGCGGACACCGGCCTCACCAACCTGGGCTTTGCGCCCAACTG
GGGAACCATCGTGCTAGCCTACCTCTTCATGCAGCTGCACATCACGATCGCCTTCGCGGTGATCATCAACCCGGCGTTCTACATCGCGGAGCGTCTGTTC
CTGGGCATGCACAAGGCGGAGCAGGGGGACCTGGAGAACGCCACCAGCTACCTGCAAACAACTACTCCGGCTGACCCAGCCGTGGTCCGTAACTCCAAGA
TGTCGTACGTGTCGGTGGCCGACGCTGAGAACGTGCACAAGGACGATTCCGAGAAAGAAGCGATGGAGTACCGCGGTGCGAACGCCATCAAGTACGTCGT
GCTGCGGTTCATCCTCGTGGTGCTGCTTGTCATCATTTCGATTGTGCTGAAGGACGACTTCACGTCCCTGGCAGACTTCGTCGGCGCCTCGTGCATCACG
GTGAACTGCATTTTGCTGCCTATCGTCTTCTACCTCAAGATGTCGTGGGAGAAGGCTGCGATGTGGGAGAAGGTCTCGGGGAGCATCGTGGTGGTGATCT
GCTTTGTGTTGGGCTGCTACGTGACTTACACGACGGGTAAGGAGCTATTTGCTCCGTCAGACGACGAGGCGGAGTTCCCGTACTGCACACCGGAGTTCGA
GAACACGGTGTACTACAACGTCAGCGCGGCCAA