Description :
From Genome Similarity Track
Location :
Scaffold_46:255683- 256864
Transcript NameFunction/comments
Physo_136513reverse transcriptase
Physo_136514hypothetical protein

Sequence
1181 bases(100 bases per row)
AAGCGGAGCGGGTAAATTGCGTCGTTGAGGACGTGCTCCGCAGCATTTGCACCGAGACGCCGGCGCGTTGGAGCGCGATGCTGCCACTCGTTGAGTTTGC
GTTGAACAACGCCGTGTACGCCTCGACAGCTACACGCCGTTCTACGTGAACCTCTTGTCTCATCCCCGCGTCCCGCTGACGCTGCCACACGGTGGCCTCG
GGCTTGGTGGGGGAGGGGAAGCCGATTTAGCTGGTCGATGTCAGCCCGGCTACTGTTCGTAAAGAGGTTGACGCCTTCTTGTCGACGCGTCTGAGTGTCT
TACGTCATGTGCATGACGCGATGGCTGAGAGCCAAGACAAGTAAAAAGAACATGCAGACGCCAGAGGCAGAGGCAATGTTGAAAGTTATGAGGGCGGGGA
CCTGGTGCTGCTTAACGCTAAGAACCTACCTACACATGAGTGTCAGCCGTCTTCAAGACGAAGTTACACCCACGCTTCATCGGACCGTTCAAGGTTGTGG
CCAAGAAGGGCCTTGCGTACACGCTCAATCTTCCGAAGAAGATGCGGACGCACCCCGTCTTCTACGTGGGCTTGCTCAAGCCGTACCAGGACCCGATGAA
GGCACAGATGGAGGCACCGAGGGTGACGAGGTCACAGGCGCGGAGGTCACGATCGTCGAGGAACCAGTCGCAGGCGTCAAAGGCGCGACCATTGACGCGG
GCACAGCAGGAGCCGCAGGCGCAGGAGGCGCAGCAGGCGGGGCCTGCATGCGGGTCAGGAGGTCGGGCTAAACCTGGAGCACAGCCTGCTGACGCTGTTG
CTCCACTCTTCGCGATCGCGAAAGCAGTTCCGTTCAGACGGACGGAGTCCTCCTCCAAGACTCCGAGCTGGTCCCAGACCTCCCGAGGCACTCCAAGGCA
CTCCACCCGCTCAACGAATCTATCGCCATCAGTCGCACAACGTGCCAGACGCGCGTCGATGTCGTGGACGTGGTCCCGAACGCGACCTGCCTGTTGCTGA
GTCTCGTGCAACTCGTCAAACGTCGCGCGGCGGGTTGGCGCGTCCTTCACCGGCTCTGCTCGTTGAGCATGGGAATCGGCATTACCATGTGGAGCGCCTC
CTGGCGAAGCGGCGGTGCCAGGGTCAAAACCAGTATCTGGTGAAATGGCGAGGGCACCCTCACTCCGAGAACTCATGGGAG