Description :
From Genome Similarity Track
Location :
Scaffold_51:255625- 257473
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15733hypothetical protein

Sequence
1848 bases(100 bases per row)
AATACAACGAAGTGGGTCTTGCTAAGTTAAAGCAGGAGGCGGTAAAATGCGGACGTGGGACTTTGTTGAACTAATGCCTGTAGAACTGTTGATGCTTAAA
TTTGCCATAGAGATCTTGAATCCTTTCCAATTGATCCGATCATTTATTTTCTGATCAGGACATCAATAATAACGACATCGCAATTATCTGAGGAACGTCT
CCATAAATTATGCATCGAAATTTTCAATAAGCTACGATTTTCGGGCTTGGCGTTGTTTAAGGCCACTAACGGCCCCCTAAGAGCAGTTGTTTGCTGACAT
TGCATCTTTCTCATAAACGCCAAAGATTTTCAATTTGATGAAGAATTTTCATGGTCTTGCACAGATTAAACCAGGAAAAACGACGGGGCGTAACATAATA
TTCTGGCTTAATTAATTTTGAAAGAGACTCATAGACTTAATGCAATCAATTCTGGACTGAGGCTACTGTACGAAGGAAACGTATTCGCGCATTCTTTTAT
ATATATAAAAAGCCGTCACCATCTCTAAAGACTAGGTCGAAGCAAGATATGATCGTGATCAATGCAATGTGATCGTCGTAGAGTATATTAGAATTACAAC
TTACGTATAGTTCATGCTATTTCTACACATGGTTCAGTCGGTAATCCTAATATACACCTGCCGTTCGATGAAATCTACCTAAATTAGTCTAGATGCGTGC
TCTTGGAGCGTGTTGTGTGACGGTTTAGCCACCACACAGCGAGTATATCTCTGGAACAAAGGGAGGGGGCGCCGCAGCGTCGAGACAACCCAGTAGTGAG
TTGAAAGCTGACGAATCGGTCCTTTGATTGGTAGACGTACAGTAGTAGTACTGCGATGCTTAATCTGCTGGCTCTACTTGGGTAACGACAACTAAGAACA
CGAATCTGTAGTAGCATGTATGTTGAAAAGGATACCAATTGATAAATGAGTGGTTGACGGTGAAGTATTTGGGAGAATTTTGATCCTTCCCCCCACCTCA
TATGGTAGAATTTATTTTGGTTTGTATACAGTTCTGATCAGGTTGACGATCAGGACTTGTGATATGAAGTATGAACTGATCATTTTGTCATTGGAAGGAA
GTTTTTGTATGGGAAGAAGCTGAATGCATTGGATGACTGTGCTAGTAGCTACCTGGCGTGGCCAACGTGGGGAAGAAGTTAAGTGCTTTGGAGGGTTGTG
TTACTAGATACCTGGCACGACCTAAGTGGAGACTGGAGTGGAGTCGGAGGCGCGCAGAGAAAGCGCCGTAGCTTCGTCCACATCGCTGTCGATGTTGGTA
GGAATATTGACGGGCTCTGGGAGTGGATCCGCTCGCGTGGAACTCTGTGGGCACGGGCGCTGGGCACGTCGCCAATTCGACGAACGTACTCGGCTGCTAT
CGTCTTGATGACGGTCGCAAATGTGGCCATGGAAGGATGCGGAGTAGGAAATCTACTGTTTAGCTCTCTACTGAAACGTTCGAGCGGGTTGTTGGTCCTC
GCAACGAGCTCGTTGCCGAGACCAAATACGTTCCACACGTCAATCGAGTACTGCTCGAGCCACGTCCGCTCAAAATAGCCCCAAAATTCTTCCCATGTCG
CTGTAAAGTACTCAGTTTTTCCTAAAATGCAGCGCTTCTTGATCTCTCGCTTGATCCACGTGATGCCTCTTTCTACTTGTTCATGGTCAATTACAGCCAG
CGTGTCTAACACGCCGAGTGTCATCGCAATTAGATACTCCTCATCAGTTATTGCATAGCTTTTCATTGCACGACGGAGTGCCTGTGTAGTGGGCTTGCTA
CGTGCCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN