Description :
From Genome Similarity Track
Location :
Scaffold_1239:2556- 5093
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1239-fgenesh-gene-0.0Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_1239-snap-gene-0.6Gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_1239-snap-gene-0.5Loricrin

Sequence
2537 bases(100 bases per row)
CCAACATCTCGGAGGACGCCGACGAGGACGTCGACGTGCGCTCACCGACCCAGTTATCTAGCTCGATGGAGTTTATGCCGCTGTCCAATTCACAGGAATT
GAACTCTTCGCATCGCGGCCAGCGCAACCAGAGCCGGCGACTGCGACAGGGGATCTCCAAGGAAGACCTGGAGCAGGTGGCGAGCCTCCCAGTGCGACCG
CCGCTTAAGCGAGGCGACAGCATTGTGTTCTCGCCCGTGCTCGCCGCGAACAACGAAGTCGAGCGCAGCTGGCAGGCGCGGTTCCTGCTGGGCATCCACG
AGCCCGTGCGTCATGCGCTCTTCGTGATCGACCGCTTTCTCGAGCGCATCCAGAGCCTCCAGTCGCCCACGGAGTGGAATGTGAACGAGTTTTTTCTTTG
GTTCAAGACGCACTTTGTCGAGTTTGTGAAAAACCAGCACGATGTCAAGACCAAGGTCTTGATGCCGCTGCTGCGCGTGGACTACCAGGTGAAGCGCGAC
ATCCTGGTGTGCTACGACCGGATCTTCCAGGTACTCGACACGATCGTGGCGCAGGAGGACTGCATCGTCTTCTCGGCGGCGTCGGCCTCAAGCTCCTGGC
AGGACCAGCTCTTCATGCTCCAGAGCGACATCCGCAAGCTCAGTCTGCTCATCAACTCGATCCTGACTGCTGAGGAGAAAGTGCTGAGTCCACTGCTCGA
GCGCACGTTCTCCGAGCCCAACTTCCAGCGCTACGTCGTGCCGCGGATATTCCGCGCGAGCAAACCCAAGCGTGTCGTGATCCCGTGGATTGTCGAGCGG
TGCCGGATCTGGGGCGGCGACAAGGCGGCACAGGCGTACAAGGATGAGCTGCCGTTCACCGCGCGGTTCCTCTACGACCGCATGTGGCTGCCGTACTTTG
TGAGCCACGTCGCACAGGCCATGAAGCACCTGGACACTGAGATGACCGGCATGGTCGCCGACACCTCGGACTCCTCCTGGTTCACCTGCACGATCATGTA
GATATCCCTTCTTGCTTTGCAAGGAAACACCCAAACAATCCATACGATCTCGTGGAGTATTTAAGAGAGAAGGCGGAGAGTATGAGGAATGACAAGAGTG
GCAAGTTTATATTTTTTTATTAGAGAGAAGCGTTAACGAAAAAATGAATGGTACATTCTCGTTCAGCTTTTATCTTCTCTCCATCCACAGAATGGGCAGA
AGAGCGGGCTGAGGAACTCGAGCTGCCGTCGCGCGTGCTGTAGCTGCTGGTGCTTTGCATGGAGCTCCTTCGTGGCCTCGAGGACCAGCACACACTCGCT
CTTCTCGCGGACCTGGCGCTGCTTGTGCATCTGCAGCGTCGCGATCTCCTCTTTGAGCGATTGCAGCAGCTCTTCGTTGGCGAATTTCGACTGCAGATCG
CCCTGAAATACGTGGAAAACGCGCCGGCAGTCGCCGCAAATGCCGTACTCGGCCAGCGAGTCGCTCCAGTCGCTTGTTTCGCCAGAAGTGTGGGAAAATG
GCCCAAGCTCTTGAATTTCTTGCCGAGATATCACCATTTCTTCAAACCGGAGCTGCTGCTGGTGCTGCTGCTGGATTTCATCGAGTCGCTTATCAGTGTT
CAAGTGGTGGGATCTGCTCACCGAGAGCACATAAAGCTGCTTTGTGACGTTGTCGATCGCCACGACAACCACAAGCTGCTGCTGCTCTGTGTGTCTGAGC
GTCAACAACGACCCGAGTTGGACCTAGGCATACAAGTACATACAGCACCCAGTCTCTGTATATAAGAAACCTCGCTAGCAGTTCATGCACGGGCAGTAAA
GAAATAACCAAGAGCCAACCTGGAAGGCGTACTTTTCTAGCAAGAGCCACGCCGGTCGCTGCGGCCGAGCGCACAGCCTACAAATGGGGGCTTGAGCCTC
TTTCTCGGCACCTGGCGCTTTATTCCACGAGAAGCAAGTGCAGCACTGCCAGGGAGCAACAAAGTCAGCAGTAGTGGATACGTTCTCAGTCGGGAAGATG
CCGAAGAAGACCACACGCATGTTGCTGAGATGGGAACGAAAGGACGCAATTGAGTGATGTTGAAGTTTTCAGCAGGAAGGTGTGTCTGCTTAAATTACAG
GTATAGTCACAAAGGTATTCAAAATAACAGTAGCAGCGTGTGCGACTGGTACAGAGCTACTTACAAATGATTACCTTTATAAATATATATCTGAATAATT
TATTATACATCCATGTATGATAATGTCTAGCGTTAACATAGCGCACGCTAGATATGATTAGCAATACTTAGCTTTCAGAACGTATAGCCTCTATAAACCG
ATTTAAGTTATCCTGATACCGGATATCGATTTCGACAGACTAGAGAAAGTCGTGACGGCTGGAAAGGTGCGCATGGAGCGATGAACACCGTCGCCGCGAC
ACCAGCAGCTCCGCCGCCGCCGCCGCAGGGCTCACCACCAGACGCCGCTGCTCCACCTCTAGCCCCACTTGAGCCTGCTTCACTCGACGTCGCTCCTCTC
ATACCTCTCGTGCTCGTCGGCAAGGATGGCCAGCCTG