Description :
From Genome Similarity Track
Location :
scaffold_320:25552- 31397
Transcript NameFunction/comments
g7226.t1hypothetical protein

Sequence
5845 bases(100 bases per row)
GATCGTCGGACAGTTTCGACGGCCTTGAGAATCAACTCCAGCGAACAAACGGAGCCAGCGCGCCGAACAACCAACTGCGCCACTGCTGCAGCCTTCCTTG
TGACTACCAGGTCAGTATTTGAGCCAACAATTGCAGTCTGTAGAGATCCAAACGCGTTCGCAGCTTGCAGTGCCGTTGCGTGCTGCTGAGTGGCGTCCAG
CTCTCCCCAAATGTTGTCTTGCAGCGTTTCTTCAAACAGATCCATGAGTGGCAGCAATAGAGCTGACGAGGCTGCACGCTTCGACCCCAACGACTTGCTT
GAAGAAGACACCGCTCCGTACCTCGAGAATTGCACAGCCAACCATTCCACCAACGCTGTTTTGGTCACGAGATAGACACTCCCTGAAGGCGTTCGCAAAG
CTGCCAGAAGAATGCTCGTAATCAATGGCTGCGTGTGCGTATCCGCCAACTCGGACGTAAAAAAACTCAACAGCATCGGAAGTACGTGGCGTCGTACAAG
CAGCGCAACGTCATCATCACCTCGAACTCCACGTCGGAGCATGTGGAGAAGCCACGAACGTTCTTGGCGGAACGTCAGAGGCGTCCGACTGTTAAACAGT
GAGTAGAACATCGGTACATCGGCCAGATCCATGGCCGGGCGAGCCAACAGGAAGTGATTCACTTGCTGATACAACACGTGCGTCGGTCGAGTTAACACAG
CAAGCGCGTCATTGAGGAACACAGTGACAACCGACGGAACCTGCTCGAGCGGCTCCTGGACCCCACGGCGGAATACGTCCAGCAAAAGATGCACTTGTCT
CCCCGCTTTAAAGTCGCTTGTCGTTTCCGTTGTTGCCTGTAGAGTCTCATGAAGATGCGCAAGGACACCGAACGCGTATTCACGCATCTTCTCCACGTCA
GAAGACGTAGCACGAATAGCCACACCAAGTAAACCTTGAAGCACGATGTCACCGTCCGGCAAGTCCGACGAGGAGATGAAGTGTGAAAGCATCGGCAAGA
GGAAAGCTGGATCATAGACTTCAGTTTGCTTGCCATCGTCACCACTTGGCAGGTCCGCGTCAAGTTCCAAAAGGTAGGAATCACCTGCGGTTGAAGCCTC
GCGTTCTAACGGGAAGTGCTCGACTGTGGCACGAATCCGATTTTGCTCGAGACCTCCACCCAACACCCAGGCGGAATCGTCAACCAGATCATTGTGGGAG
CGCTTCGATGAAAAATCCGCTGTAGATGACGCACCGAAGCGGAAGCCCATGCTTACCAGTGTTAGTTCTTCCTTCTGGGCCTCGAATTCGGCAAACAGGA
CCCGCAAACTGCGATCAAACGGAGAGAGCGACATCGAGTACGAGCTCAACAACGTCTGTAAGAGCGAGCGCGTGTGGTTCCCAGTGATACGAGCGAGTCG
AGCAACAACGCGCACCAGAAGAAGTCGCACAGAGTCATTGTCCGTCTTCTGGAGGATCTGAGCAAAGCACGAGTGCTGAACCACAGTGTCGAATTGTGCT
GTAAAGTCGAAGTCGACGCTGCTCGAGTCGTTACCCACAACACGCAGTAAAACTGCTGTCAACTTGACAAAACCCTCGAACGTAAACTCGTTGGCACTTT
CTTGGACGACTTCACGCACCTCTGCAAGTAGTGGAAGGACCATCTTCAAAGCGACCAGCTGCTTTTCTTGGGACTGGTCCTTAAGAAATCCAACAACTCG
TTCGATCAGCAGCATTGTCGCTTCATACTCACTCGGTAAACGCTTCTCTACGTCATTTTGCGCTGCCTTCAGAGCTGCCAGGCTGCTCCGAACGAGAACA
AGCAGTAGACTCACGTCCACATCGTCGTTACTGCCACTGTTGCGCAATAACAACAGTAATCCAAGCAGCTGTGTAGAAGAAAGACGCTCTTCGCCTTCCA
ACCTTGCTAGTTTCTTCACAACATCGCCAGCAGAACCATCTAGCGTGTTGATGTTTGTGCCAGAATCGACTGATACGTGCTTCAACAGTGCAAGTTCTGC
CGCGTAGCTTCCCTGGAAGCCCAACAACACGTGCTTGTTGCAGACTGGAATCAACTGCTCCACAAATTGGCGTAGATTCTCGCTTACAATTCGCGTAAAC
ACGTTGTAAATCGCCCCTACAAGCTCACACTTGACGCGATCATCCTGCTCTTGGTGAAGTCGTTTCAGCAGCTGCTCTTGAAACACCAAGGGGAAATCTG
CAGCCTCGTTCCCACACCGAATTGCTGCGATAATAGCTCGCAGCACATCGGTGCAGTGTGCTGTTGAATTCGTTTGAGCACTTCGTACTACAAGCGGCAC
TAGAGAGCTTCCAATAGACGCAACAGCACTAGACGCTTCAACTCCGCCCAAACGTCCTAGCACCGTGAATCCAGTCGTGAAAAACGACACCTGCCGCTTG
TTCTGGCTGTTCAGCAGCTGCCAGAGCTTACGCGTGAGCAGCTTCGCGCGCTTATAGTCCGCGAAAGAGTCAAATTGCTTGTCACTATCTCCCAGAGATT
CAAGAACACGCTCGATGAGCACCACGTGAGGAGCGTTGATAGTCGTCGTGCTGAAATTGCGCAACAAACTATCGAGCACTGGGATACGGGTACTGGCAGG
AGCGCGCGAGGCCAACATCGCTATGATCGGTACGCCAGCACGTTGAAACAGGCCGCTAAAGTCACACAGGGACGATAAATTCGTATCCGGGTTGTTGCTC
GAGTAAATTCGGAGAGAAACGATCTCCACAGCTGAAAGTTGCCGCCACAAGAGAGAGTTCGAAACACTGTCCACCACTGCTCGCAGCTTGAAGAAGATGC
GGGCCACTACATTGAAGGGTGGAGAGTCCTCGCTAGAGACGATAACAATCGTCAGTAGATAGAGAAGCAGTTCACACAGCTGCGTAGATCCACTTGCCGA
GAACTTGGAATGATTAGAAAGGAAGAACAGCACTTGCTCACACATACGCGCCGATTCCGTCGCTGACACCTGACGGTTCTTGGCAAAACGAACCATTGAA
GCAATTGCTGACTCCTGCTCTTGAGAATTCTTGCTTGCAATGCTGAAAAGAGCATGTTGAAGGACAACAAATACTGGGATCGCCTTCGTGAAAGTCTCTG
TGGCAGTCGTCTGCTTTTTCTTGCTCGTCAGGAGTGAGAAGATGTCCACGTCTCCCCGCGCAGACAAATAATGGATCACCGGACCGAAGGATTCATCTAC
ATCCACGCAGTTGCTGACAATCTTCACCCAGGAGGAAGTCAAATCTGTAGGTGTCATTGTCACCAACGCAGCAGTGAGAGCATCCGGGTCGCTAAAGCGG
TGCCAGTTGCTGCTAGTCGCCCGCGCTTTCTTCTTCGGGGTAGTATCATTCTTAGACGCTGGCTTTCCGGAAGGAAGTGTTTCACAATGAGTTTTTAGCC
AAACGTAGGCATCTTTAAGATCAGACTCCTCAGAACCCACCGACCGCTTCCTCTTCTTGCCGTTGGAATCGCTGTTGTCATCCGCTTCTTGCTTAGCAGT
CACGTCCATACCAGTAAAAGCATCGTTGCTGGCAATCAGAGCAACCAGTTGCTGCGGGTGTTTACTGGTTGGCATGAGAGATAGCAAGATCCGCACAGCA
AAGGCTACCACGCACGGGTCATCACGGTACAAGGACAGATCTGTCGTCCCAATCACTCCACGTGAATTCAGAAATCCCACCAGGGCCACAGTAATCGGAC
TCAGGGAGGACGATGAGGACGCGTCAACTACGCGACTGCCAACCGCAACATACACAAGAGGATCTGCCATCACAGCACGCGCGAGCTGTTCCGTGAACTC
AGCACAAGTTTTGCTTCCGCCATGGCGTAAGCTCTCGAGCCAAAACGTAACTTCTTCACTTGCACGTCCGCCATCGAGAGCTTCCTGTCCGAATATGTCC
GAAGCGAGTAAAGCACGCTGAAGCACCTCCCCTGCCAGTTCTTGAACAGTATCGCTAGTTGAGACGTACAGAAGCAGCATCTGCTGCAGCTTTGACCGCT
CAGCAGAGCTTCGACTGGTGAAGAGGAAACGCAGACGAGGGGTGTCCACAGCAAGCAGAAAGCGCAGCATCTCACCAATGATCAAGCTTCGCATAGGTAC
CGGCAAGGCATCTTCATAATCGTCCAAGTATCGCCATGTAAGAGTCTTGGTAAAATCAACCTTCACCTCACGCATCGTCTGTGGAAGACACTCCAGATAC
AGGCGGAAGACGGTGAGTGCACGCACGTAAATGAGCGCCACGCTCCGCTCCTGGGAAGCGCACAACTTGAGCAGCAGTGAGACAAGCGCTTCCGGACTGG
GAAGCAAGAACCGCAGCTCTGACTGCACTTCAGAAGCCACGCCCAACGATTCCAAAGCCGACGCTAGACACACGTAACGCTTCAGTGTCGCCTCAATCAC
GCCTAAGGACGAGTAGATGACCAGGTTGTTGCTGTGTTGGATACAACGCGAGAGCTCCTTGCGGTAGTTGCCGGGTGCGATTAGTCTCGACGCCAGAGAC
TGAGCAGAGCACCATGACGAAGAATCCCCGCTTTTGGTCGTGGACAGACCCGTCGCTACTGCATCCAGGGAGCAGGACAGCAACTTCTGCACCAACGACG
CCACACAGAACCAGCGGTAGACTGGCTTCGGCTCTAGCTGAATCGACAACGCAGCGAGATACTCCGACAGAAAGCCCGGATACTTCACGAGAAACTGCAT
CACGAGTGTCTGCGCTTGACTGCTGTACAGTAGTTCATTCACGCCGATCGTACCCACCGCATTTCGGATCACCTTGAGTGCGTATGCTTGTTCCGACGTC
GTCACTTCCTCATTTCCTAGTGAATTCGACGCCGACTTGGCCAGAAAGAGCCTCAGCGCCTGCGTCTCAGGCACAACATACAGCGCGCTGTTTTCAAAGA
ACAGCGCGTTCAGTACACCTAACGCTGTGTCGCGTACGCTCTCGTCGTCCTCCACTTGAAGCAGCGCCAGCAGTTGATGCACAAACGTGGCGTTAAACAC
CACGAGCTTGTTCTTATGCTCCACCTCTGCATTATGCAGCACGAGCTCCCCCAATCTGCTGAAAATTGTTGTCAATACTTCAGCTGAATCTCCATCCATG
CTTTTAAACAGCGAGGCCGTAAGTCCTCCCTCTTTCATGGCAAAGCGATGGACACTTTTATCCGGACAAGCGGTGAGTGCCAGCACCAGGTCCACGTAGG
CTGTTCTCAGTTGGAACGGGGCTTGTTTCACCTCTTCTTGGCCGTCTTCATCCTTTACAGGCTCTGCTTTCTTCCACCGTCTCGTAGCGAGCTTGGCAAA
AGCTCCGCTCTGGAAATTAAACAGTCTCACGAGCTCTCTCGCTGCAGTTCCAGCGACTTTTGCTACTGTTGCAAGCAGCTCCAGGGCTCGATACTCGATT
AGTGGCTTGTCACTCCAGCTCAGAACCTTCTCCAGCTGCGACGTCTTCTCTCGAATAACTCGGAGCGCAAACGCTTCGGCTTGGACGGCATCTCGACTCT
GTTGGGCCTGCAATAGATGGTTTACCACGTGCAAAAAGGTCGCGAAGCTCTCACGCTTCCCCCAGCGACTATTGGCGCCGTGCTGATCCGGCCAGATACG
CAGCAGCAGCTCTCCTTGAGGGTGGATGGACAGGAATTTGCTACACAGAGCGGAGGCATCTGCGGACGTATTCTGCGAACTCTCAGTCAATTCGTCAGGT
GGAGAGAGCTGCAAGGCACGCGCGAAGGACACGATGGCGTCGTCCAGGGGCTGGCGGTCGCGCTCCGCCGCTAGAAGCAGCTCCCGCAGCGCCTCCATGA
TGACCAATTGGTGTCTGTTTGTCGGTTGGCTCTGGGTGAGTGTAT