Description :
From Genome Similarity Track
Location :
Scaffold_280:25550- 27757
Transcript NameFunction/comments
Albla_Nc14113350DNA repair and recombination protein RAD54 putative

Sequence
2207 bases(100 bases per row)
CTCTTTAGCTTGGATATTTTCTTCTGCATTTTTAACTTCGCTCATTTCTTGATACTGAAGCAGTAATTCCGAGTCAATCCGGCAGCTAAAGGCAAAACTG
ATTGGAACTTTGCTTTTTTCTCGTGATTGTAGCTTCCAATCCGGTGATAGCTGTAGTTGTCTCATTGCTTTTTGCATGATCTCGTCGTCTACGGAGTCGT
AGCAACGATGATGGCCCCAGTTATTCAAATCTTCTTCGCGTGGTAAGCCGATTTGTGCATGAAAGTATTCGTGGGACAATGGAGTCTCGCTGATTGCCTC
ATTCAATTCCGCGTTTGGAGATCGCATCGAATCTATGTCGTTTTCCTGGAGACGCCATTTACATCGGGTACAGCGTAAACGATCATGCGTGTCCGATTCT
GTCGCTTCTTGTAGGACGAATAGCTTCTTCAGATCCTTTGAAGACAGTGAATTTACTTCGTCTTTATCATCGACGATACTCTGAAGGCCTTCTTTCGATA
GCTGTCGTTGGAATATCTTTTCTTCTAAACTTCCAGTAGCCAAGAATCGATACACATAACACATTTGCTTCTGTCCTTCCCGCCACACTCTTGCTGCTGC
TTGTTTATCTGTGGCTGGATTCCAGTCCGGGTCGAAGAGGACCAAACGATTGGCTCCAATAAGGTTGAGACCGCAACCCCCAGCCTTACTCGACAACAGA
AAAGCAAAGGAATGCGTAGTTGGATCGTTAAATACATCCACCATTTGTTGACGCTTTTTCGGACTGATTGTACCATCAAGACGAACAAACGGCCAATTTC
TCTCGCTGCAAAGTAGTGACACCAGATCCAAAGTCTATGTAAAAAAACATTTTGAGGATTCCGGTTCTCAAGTTTCAGTGCCACCATACCTGGGTGTAAT
TGGAAACCACAACGATACGTTCCTTTGTTTCCTTCCTCATCATCTGCATTAAATGATCCAGTAATTGCAATTTCCCAGACCATCCAGGATGACAAGTTTG
CTTCTGATTAGTTGAGAATGCTCTTTGTCCGCTTGTAAAGTTGTTCTTCTGCTCGGAAGCAATGATTTGCTGGCAGTCTTCAAATCCAGGTAGCTTGAGC
AATGCTGTTCCGTCATCTTTGAATAGCAGTAACGGGTGATTGCACAGTTTTTTAAGCGCTGTGATCGATGGTAAAACATTGACGTTTTGCTGCTTCATGA
TATTGCGCATTGCCTTTGACTCCAAAAAGCGCTTGTAGAGCTTTTCCTGGAGACTTGACAACGGACAGCAGATGACTTGCATCAGCTTTGGTGGGAGGTG
TTTGGCATTCAAAGTATTTCCGCGCCTTAAAATAAATTGATTGACGATATTGCATAAAGTCCACGAGCATCCTTGTGCAAGGCTTTGTTCCTTGTCGGTG
GCGTCTGGTTCTCTTCCACGTAAAATTGGTCCCATAAACTGTTTCCGAAACTTGGCAGGAGTTCCAAGAATATCGGGATTCGTAAAGTCAACCATCGCAT
AAAACTCTTCCAAATCATTTTGCATAGGTGTGCCCGATAACAAAACCCGTCGTCGACAAGCGAGTGCCGCAAGTGCTCGATTAATTTGTGAGTGTGAATT
CTTCAGACGATGAGCTTCATCGCATATCAAAAGATCACAGCATTTTGGAGTCGAATGAAATTTCGCAGCGTGCATTCTGAATGTTTCATACGAGAGGATG
AGAACTTTTGAACTTGTTGGAGACGTCCGATGGTGAGGATGACAGCTCGAGTCGATAAATCGATAAATCTCCTTAATCACGTGTTCTCTGTTTGATTCGA
ATAAAGCGATTGTCTTGATGCGATTTTGCAGCCACTTTTGTATTTCGTCATTCCAATTTTTAACCAGTGAGGTGGGACAAACAATAATAACACGATGTAT
TGTCGGTTTTGTTGGATCCTGCATGCTTGTCTCCAATAAGGTGTGCATTAAGGTAATGCTCTGAAGTGTCTTTCCTAATCCCATATCATCCGCCAAAATG
CAGCCGAATCGTCCAGCATTCTCGACATCAGCCACTATCATCCACAAGAAGAATTAGTTTATAGTGTAAACCACTTGAATGGATCCTACCGCAATCAAAC
AGGAATTGTACACCATCCCGCTGATGTGGTCGTAGAAACTTTGTGAGGATGTCAGGGACGACAACTCGACGTTCCTTTTCTTCTTCATGTTGCCATAGAA
TAAGAGG