Description :
From Genome Similarity Track
Location :
Scaffold_1428:2555- 6602
Transcript NameFunction/comments
Phyag_g10601hypothetical protein PHYSODRAFT_538076
Phyag_g10602Putative cullin putative
Phyag_g10603conserved hypothetical protein

Sequence
4047 bases(100 bases per row)
TGTGGATATGGACCCGgccgaagagcaggagaagaagatttACCAGATGCAGCGTGCCAACGGTGATGCTagcgccaagaagcccaagaagaaaatgcgC
GGTAAGAACCGTCCGTCGCGGCGAttgcgcaagaagcagcagaacgtcgtcgacgcaCAGAAGCAACAGTTCCGCGAGCAATTGGCCAACAAACAGAAAC
ACCAAGAGcgacaggagcagcagcgcgagtgGAATGAAAAGGCTGAGAGCGCGCCGACGGCGCTCAACCGGTTCTTCAAGAAGTAGATGCATATCCACAC
TGTAATACAAGCAGTCCGTTCCTTAGACACACATTTCATTACTCTTAGCCATCCCTTCTTGTCGTCACTACACCTTCAGGGtatctccaccaccgcccgC
ACAAGACTACTGAGCTGCAACAAGACTGACGATATCATGACCAACGACACCTTTATTGCGCCATAAATCGAACCAATTTCCTGGCCTTCGTTGCGCTAAT
CAGGCAAGTAGCTTATGCGAGGTAGCGGTACGTGTTGGCTTGATCGGGGTCGCGCTCGAGATACTCACGGTCGATGAGGGCCTCAATACGGCGCTTGATG
ACCTTCAGATTCGGCTTGAAGAACGCCAGCTGGCTCAACACTTCCGAGATaagctgttggtgctgcagcgtcttgcgcGCCTTCATGATACGCACGATCG
CAGCTTCTATAGCTATGCTGCGATCCTCCTCCACGTTCTTCTGGCTGTGGCTTTCTTCCAAAGAAGCCATCGGGATACGCAGCTTGCGCATCGGCGACAC
AAACTTGCTGTTCACGGCGAAATTGTCGCTTTGCGAGATAGTCTTACCGGCAGGAGTCTTCGTCAACAGCTTGTACTTGCCGCAGGACAGCGAGTGCATA
ATACGCTTGACCACATCCACCGGCAAGTTCAATGACTCGCGCACAGCCTCAAAGGACAATGCACCCTCGCCCTCATTaaacaacagcagcgccacagcct
gcagcgtcgtcacctgGAGATCGTACCATTTCTTTTTAGGGAAGTTGGCACGGATCGTTGCGTTACCGAGCGAGTGCACCCACTGTAATCGACGGTGGCT
CGTCTTCGAATCGTAGTACACCTTGAAGAGATTCATGCATCGTACCATGAGCGGCGGCATTGTGACTTCAAGGATACGGTACGACGGCCAGTAGCCCGTC
GTCAGCACCTGCACGCTGAACTCCAAGTTCAAGGCAGCTTCGTTCGAATCGCTCTCACGCTGTTTCTTCAAGAAGCCCTCGAACTCCTGGTGGTGATCAC
TGCCGATGGCCAAATCATTCATCATACCTTCCATCTTACCCGTGAACTGCGCACCAcagcgcagcttcagcttaCCAATCATAAGAACCTCGGCATCGGC
GGAAGCAGATCTCTGGTTTAGCAGACGCTTGGCTAGCTGGTTACGGTAGATCTCAGCAAACAGATCCTTGTCCGTGAGGTACGAGAACACAAACACCACC
TTCTCAAGATagtcctccacctgctcgtcGCTAAGCTTCTCGCCACCAGTCTTCAGGATACGGTCGCAGAACGTGCTCATTAGCTTTGCTGAGCTGTCCG
GGCCGACATCCTTGTTAACGAATTCAACGAAGGCCTCCTTCAACGCCTTCTGGAACAGCGAGTTACCAGCGAATTGCTCGTTCACAATGCTGCGGAACTT
ATCGTGGATAGCAAGAATATCCTTGATAAACGTGGGGTCCGAGCTCGGATCACGCACGTTGCCCGAAGCGACAGCATTCGCGCGCTTGGCAACAATGTCA
TTACCCACCGCGGTAatatgctgctgcaccaagtCCGCAATAGGCTCCAGTCCGTTCTTCAGACGTGCAAACAGGCGGTACATGCGCGCCAAGTCCTCCA
ACTTGTCGTTCTTCAGGAGTGCAATCACACCCGAGTTCTCTCTCTCAATAAGTTCCttctgcgccgcctccagcaacacgctctccagcttcttgacaAG
CTTGGGCTCCGTAGTCTTATGCAAGTACGTGTTGACACGACTTcgctcgctctgcagcgcttcctcgaCCTTCTGGAGGTACACAGGCGTCGAGTCTTCA
CTGAGCCAGCCCTTGGACTTGCGTTCGTAGTACGTAGCACTAGTAGCCACGAGATCCGCCTCCAGACAGCTCTGATACACATCCAGAGACTTCATGCCCA
TGACCTCGAAGATCTCGACGCAGTTGCGCATGAGCGTCGTGTCGATGATCTCTCCgttgcgctccttctcgatgaGCTCGATCATGGCGTCTTTGACGCG
CACCTTGACCTTCTGGAAGACCATGTGGTCGAAGCTCTGCAGGCccgcgtcgtccagcgtcggcagcgagTGGTGCTTGACGTAGTAGCGGTCCAGgtac
atgaagaagcgcgtcatccacttcatcatGAGCTTGTGGTTGGTCCAGCGcttgaccagctcctgcaggAAGAACTCGTCGTGGGCCTGCTCCAGACTGG
GCAGCACTTTTTGCTCCAGATAGGCGTCGAACGTTTGGCCGTGGCGGTCGTAGAGCTGCTCCGAGAAGTTGTACGGCGAGCGCTGCGTGCACATGTTGTA
GCACGTCGTGTAGATGGGCATGAAGGCGTTGGGCGGGAAGGGCGACACCTTGACCTGGTCCAGGCCCTTGTCCAggatgtccagcagcacgtcgatGGCC
TTGGGCTTGATCTCCTGGTCCCAACCTTCCTCGAGCGAGATCATGTTCTTCCCGCTCATTTGGCGTCAAGTTCGAcggcaagcgcaagaagcttTCTGGG
AGCTGCGCTATACCGACGTGAGTGGGTAAAGTGAAAGTGCTGGTCACTTTGCCTCCCTTCTTTTCCCTAATAAAAAAGATCGAGACGGCGAATCCTCTGG
ATAGCAATATGTATGTACCCATTTTGGGCTGGTCTTCTCCCTATTAAAGAATAGCTTTTTATTCTCTACACCAACGATGCCAAACACGATAGAATCTAGC
CTTGTTTCAAGAATAGTGTTTAATTTAGCATTTTTGCGTACTTCTACATTAGCATAAAATGGGTTCGACATCTTTTCTCGTCctgtgattggtcgaaaat
ATCATACGCAAAAAGCGCCAACTCAGTCCCAACCAAGTGGCGCCTGTCCTGCCGCCTTCCTCCCTCTGCGCCACGCTCCACGGCCACCGCCCGCAGCCAA
GAACTCGCCACACATATCAACCTATCCGCGCGCCCTCGCTATCGTCTCTTTTGCTGACTCGGCGTTGGTCCAATCCTGTCCACGCCTGAACGGCATCAAA
ACCCGCGAGTCATTTCCCTGCAAAATAAGGAGACCCTCTCTACGCCGATACCACATCTATTTAAATAGATCCTCTGTTATCTGATaacttcaacatgctg
cGCGACATCATGATGGGGTCGTGGGAGttcgccgcctccttctgcgtCGGCCGTAGTCGTGGCTGCGAGGTGAGCATCCCCACGTCCGAGGAGACGCGTA
CTGTCAGTAAACGCCACGTGGGGATCGTCCCTCTGACCGAGACATTGGCGACTTCATCCCAAGCGAGTCCAGGCAAGCGACGCTGGCTCATCTACGACCT
GCAGACGATGAACGGCACGGCAGTGAACGGAGTGGAGATACCGAAAGGAGGCAACCGAGAGCTGCAGAATGGTgacgaggtggtgctggcctcGGCCATG
AGGCAATGTGTTCGGCTTCTGGTACAGTTCCCGGATAATTCCCACTCACGCATCGTGGTGAAGGCATTGGCACGCTCGGccccgtcgtctccagctccat
tgCCTCGTCGTCTGACGACTCCGAGGCCGTCCCCACGTCGCTCACCACGACGCACTGTGATGACGAACGCGtcggtggctgcagcagggCTCGGGAGGTC
TGCTGTTACGATTTCAGGAAGTCCGACGTTGCCAAGGACGGGATGCCGTCAGTTAACGGggacaccaagaagcagcaatggcacCTTGATGACACCACCG
CCTCACAGCAACACACTTTCACAGAAGCGGAGTCGTAGCAGTCCGAG