Description :
From Genome Similarity Track
Location :
Scaffold_1836:2555- 6440
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_1836-abinit-gene-0.8Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_1836-fgenesh-gene-0.0Transmembrane protein

Sequence
3885 bases(100 bases per row)
AGCCTTGCGCGCCTTGCGCTCTGCCTTGCGCTGCGCGTTCACGTCGTCGGGGAAGGCCGCAAAGTCGCCATAGAACTCGCACTGGTCGAGCGCGATGGTG
GACGCTCCTACGGAGCTCTTGGGCGGTGGGTAGCGCACCAGGAGCTCCTCTGCGGGCAACTGCTGGTTGGCGCCGAGACACTGCCGCGCATGTTCGTAGC
GGGTCTGCAGGTCTGCGCCTCTGGCGGCTGCAGTCGGGTCGGCCATCTCGTTCTCTTGTCGCTTGTGTTGCGTTTTGCCCAATGCGAGCAGATCCAAAAG
GACCATCCCACAAAAAAAGAATCAGAAGGATGTTGGTAGTATGCTATTTAGTAGGTTATGCACTGCAGTATTTCATCTTTGAAACCCCAAAAGGAAGCCA
CAATACTGCTCAAAGTATGCTATTTGAAAGGATCTGATTGATTTACTCGTGGAAATGATTGCCATTGAATGCAGAGTGTTGGTACATTTGATTTGTTTCC
GATTGATTGATGAGGTGAGATGGCACGCTCGCATTGGACGTGAGTGCTCGTGTGTGTGTGCTGGCCTTTGCTGTTGGCTGCTCACTGGCTGGCCCGCTGC
CTTCAGATTTCCTCCACGTGGCCAGTGTAGCCTTCGAAGATGTCGCGCTTCTCGTCGGCGCGCGCCTTTGCATCTGCAAACCATTCAATAAATAAATTAA
TGGTTGAGTAAAATAATAATGTCATTAATATAAACACACATTATCGGACGATTCATTCGTACCTTTTGCAGCGCGCGAGTCCTTTGAGGGCTGGAAGGAG
TAGTGTGGAGGGTTGGCTGGTGGGCTGGGATGACGTGGGTGGGAAGGAGCCGGCGACTGGGGCGTCTGGGGCATGCGCTCGAACTCACGCTCGAACTGGT
CGAAGAGGCTGTTGGCTCGGTCGTCTCCACCGCCAAAGCCACCTCCAAATAAACCTAGTCATTCAAGTCAAACATAATGATTAATTACCAATTGGATTTT
AACAAAGGCCAGTGGACGTGAGTCACAACATCCAACCGCATTACCTTCGAACGGACGCAGCAGCTCTTGTCGGAAGAAGTCAAACGGACTCATCTGCGCC
TCAAAGTCATCCTCTCTGCTAAAATTTACATACACAAGCCGTAAGAAAATAAAATTATTATAAAAAGCAATAATTTAGTGCTCGCACCTCTGGAAGGGAT
CGAAGAACGCGCCAAAGCCAGGGTCATCGCTGCAAATGCAACATCACAAAAGCACATAGTTATAGTCGTACTCACATTAGCCACGAGCCTATATACCAAT
TGACATAAAGCGCACCGTTTCTTCGGGTCCATGCGCTCGCGATTGAAGAAATCGCTCGCGGAGAGCTCGCCGCCGTGCTCGTCCTCTGTGATTTCCTTGC
GATTCGAGATCAGCTCCTGCATTACCACTCATAGTGACGTGAGCACACATTCACACTACCTCATGCACTTATAACAGGAAACAAACGAGCGCACTTTGCT
CCGTCCGGGGCACTGGCGGAAAATCTTCTTGACGAGCTCGCACTTGCTGTCGCCGTTGATTGAGCGACACGACTGCGACAGCGCCGTCGAGTAGAAGCAG
CCTACGCATACACACACACGTATTTTAGCAGCAGCGATCGGATGGTCAGCTCCCTACAAGCAGCTTGTGTGTAGATGTGAGTGCTGCTGCGCACGCCGCG
TGACGCAACGCAACGCATGCGCAGCGACGCTTGAGAGCAGTCAAGCGCACATACGACAGTAGTTTGATCTGCGGCTGCGCACCTGGGTTCTCCTCGCGGT
CGCGCTGGATGAGCTGCTGCTCTTCGTCGCTCAACGTCGCCATCTTGCTCGTCACGAGTTTCTCGAAAAAATATTAATGCTGGATTGTTTTGAAAGTAAA
CTGGAATGTTTTTGAGCATATCGTACAACAATTGCACAAAACATTCTGATCTACCATCGCGTCGCAGAATTTGTTGGACAGGAAGTCGCCTGCCTCGTGC
AGCTCGCAACGCCTGGCGATAACGCGACGTCCGAGGTCTTGGAACAGCCACTTAGGACTGGAGGGATCCAGGCTTCGACGTGGTCGATGCTGGCGTCCAC
GTATTGGGACAGGGCGGCCCTCGATCCCGGCGCTCGACGTTCTCTGTCTTCTCCGAGGACTAAAGCCGTTCGATAAAGCGTCGAACCAGCACTTTCTTGG
GTGATGTCTACTCGAATCGAAGCCTGTCGTTGGTGTTAAACTTGACTCACGCGATGAAACGAGACGAGACTTGAGATTCGGCACTTGTTGCCAAAGACCC
CGTCGAAACAGACCGATACGAGTAAACTTAAACAGCCCCATCCTCGGTGTATGCGTATACTCACCGGTCAGTGGTCTCCAAGTTCAGGCAGCACTCCTCG
CAAGAGAGCTCATCTTATCTCAAATTAGTCTCAGCCATGCTCGGGCGGCAATGGGCAGCGCTCATGCACACGTGGGAGGCGTGGCAGGTGGAGCTCCACG
GCAAGTACTCGGTCGAGCGCATGCACAGGCTCCAGCAATACTCGCGTCGCTCGAGTCTTACGCACGCGCTGCTCGTGATCGTTGCCACTCCACTGCCGTG
TGTGCTGAGCGTCATCCTGGCCGACCTGATCCCGCTCGCAGCGCCCGAGCGAGGCCTGGCGCACAGCCACACATTCTGGCTGCGCACGTTCATCATCGCG
TGGATCACCAACTTCACCATGATGGAGCAGGGCCGCCATTTCACCCCGTCGCTTCACATCACGGGCTTGTAAGCCGCCGTCGTGACGTTCTTCGAGATGC
TCGGAGGCATGGTGACCGCCATTGGCTCAGCGCATGGCATCGGCTTCCCGCTACCGTTCACACCGTGCTTCATGGCACCCGGGTGCAGTCTGCTGCTCGT
GATCGCATCGACCGTGCTGTGGGGGAAGCGTGTGCGCGGTAACCCGGCCGTGCAGGCTGAGATTATCAGCTACCTGAAAGTTGTCGGCGCGCCAGTCTCT
CTCATCTTCATCTACCCGGCGTACAACTACGTGTTCCTGGGGCTCTCGTTGGCCAAGCAGACCGCGTTCGCGCTACTGCTACCCGCGATGAAGATCCTCA
CGAAGAACGCGATCGCGTATCTTGTGCGCCACATCGAAGACTTCAAGCCCAAGGTCGTGATCTTCAACGTCGAGATCCTCCACGCGCTCTTCGTCGCCTC
TTGCATGCAGCAGTCCAACGCGCTCCACACGACCATCGTGCTCATGACGATGGACTTCCTGCAGGCCTGCGCGAGTCTGCGGGACGTCGACCTGCTGCTC
AAGTCACTACGCGAGCTCACCAACTCTGCCACGCAATCAAGTGCTGCTGAAACACGGGCGAGTCAAGCCCACAGCAAATATTTCAACCCGTTGGACGCTG
TCATGTACCTTCTCTCCATCAACCGGCAGCTCCAATCGGATGGAAGCCTGCGCTTGAACTCTCAGGCAAAGAGCCAGCCGCCAAGGCCAAATACAAACGT
CATCTGGCCCAACGAAATTCGAAAGCTGAGCTCAACGGTCCCAGCGGGGTCCTCCACTCGGGTTGCTACAAAGCAGCGCCTCGAGGCGCGGCGACACTTT
GGACGGAGCCAAAAGAACGCCGTGCACTCAGGAGCCTCCATGTGGCCGCGCAGTCCGTCTATGGAAGCGCTCCTCGACGCATTCGCCGGCGCAGCCCATC
TTGATGATGCCGACAAGCAGAGACTGACACTACTGGGTCCCCAAGACCGACTGCAGGTCATCCAGCAGACGCTGCAGCTGCTGCACTTGACTGAGTTCCT
GCTGCTCGTCGAGTTCACAGAGGTGGTCGTGCCATGCATATATTGCGTCTTCATGGGCGCGGTCTCGCAGATGCCCAACCGCCAG