Description :
From Genome Similarity Track
Location :
Scaffold_164:2555- 5825
Sequence
3270 bases(100 bases per row)
CTTGCGGCCATTACCGAGCTTTCGTTTCCAACGAGTAAAAAGGGCATGCAGTCGTTTCTTGGAGCGGTTAATTACTACAGCCGCTTCATTCAAGACTTCG
CGGTCCACAGTGCGGCGCTGTACCAGCTTAAGGATGAAGACTTTGCTGTAGAAGGTGACCTTTCGGTGGCACATCGTTCCTTCGAAAATTGAAGGCGAGT
GTTTCACATTCAACCATCCTCAGGTACTTCGATCGGTCGAAGGCAGTTCATGTCATGCTCTTCGCGAATGAATGAGCGTTGAGCACGACACTTATACAAG
AACACGAAGGCAAGTTGCACCCCGTACGATTCCTCGGGCGTGTGCTTAAGGGATCCGAGATGAATTACCATCCTGCTGAGAAGGAGGTTTTGGCGTTACT
TTTGCTGTTGAAGATCTGTTATGTCCAGCTGGCAGGAAAGACGCTACATGTCTATACCCGATTCTTCGACGTTAGAGTAGGAGCATAAAGCGAAGTCTCT
CTTTGGACGTGCGGTCCGATTCGCAGTGCTGCTTTTGCAGTGGCACTTGAAGGTACAGCGCGTGAAGGAGAAAGATCCGAAGAAGCTTGCGGCCATTACC
GAGCTTTCGTTTCCAACGAGTAAAAAGGGCATGCAGTCGTTTCTTGGAGCGGTTAATTACTACAGCCGCTTCATTCAAGACTTCGCGGTCCACAGTGCGG
CGCTGTACCAGCTTAAGGATGAAGACTTTGCTGTAGAAGGTGACCTTTCGGTGGCACATCGTTCCTTCGAAAATTGAAGGCGAGTGTTTCACATTCAACC
ATCCTCAGGTACTTCGATCGGTCGAAGGCAGTTCATGTCATGCTCTTCGCGAATGAATGAGCGTTGAGCACGACACTTATACAAGAACACGAAGGCAAGT
TGCACCCCGTACGATTCCTCGGCCGTGTGCTTAAGGGATCCGAGATGAATTACCATCCTGCTGAGAAGGAGGTTTTGGCGTTACTTTTGCTGTTGAAGAT
CTGTTATGTCCAGCTGGCAGGAAAGACGCTACATGTCTATACCCGATTCTCGACGTTAGAGTAGGAGCATAAAGCGAAGTCTCTCTTTGGACGTGCGGTC
CGATTCGCAGTGCTGCTTTTGCAGTGGCACTTGAAGGTACAGCGCGTGAAGGAGAAAGATCCGAAGAAGCTTGCGGCCATTACCGAGCTTTCGTTTCCAA
CGAGTAAAAAGGGCATGCAGTCGTTTCTTGGAGCGGTTAATTACTACAGCCGCTTCATTCAAGACTTCGCGGTCCACAGTGCGGCGCTGTACCAGCTTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCAGCATGAAGAACGACG
AGAGACGTCCACCGAAGATTCAATCGGCGATAGATTTGTTAGACCATCCTGTACCAGCGGTATTTTCCGATGCGGAAGATGTCGACCCGGTAGCAATACA
GCGTGAACGACGCAGACGGATAATGGTGGTACAAGACGAAGAGCAGAAGTGGTGCTAACATCAAGAAGGTGCTTCAAGGCCAAGCGAGCTTAGTTATAAG
GAAGCTCGAGATGCCTGGAAGTACGCTGACCGGTTCGTGTTATCAGAAGACGGCGTGCTTCACTATATTGGATTGAATCGTCGGTACGACCACGGTTGGC
AACAAGAGACCAAGCTGCGGCTTGTAGTGCCGACAATGATGGTTCAAGAAGTCCTGCAGAACGGTCACGACTCGCTGGAAGGTGGACAGCAAGGTTATGT
GGTTTGAACGTTCCATCACGTTATGACCGATTATTATTGGATCGGCTTTTACGCTTACGTGGAGAAACATGTGAAGCCATGCCCGGATTGCAGCTCGAGT
AAAAGACCCCTTCCCCCCTTTGTGGGTACTCACCGGGCAACGTACTAGCTGAACGACCATTCTAGATCGTCTCGATCAATTTTGTGATCCCACTACCGAA
ATTTCGCAAGGGCAACACAGTGTTGCTCCTATTTCAGTGCTCGTTCACGGGATTCGTTATTGCCAAGGCTATGTCGGATACGACTGCACTGAGTGTTGCC
CAAGTGTTCGAAGAATGTGTGTACCGACGGCTCGGAGCCCCATCACTGATAAGGCACGACCGCGAACCACGCTTCAAGAGCGAGGTGTTCCAAGCATTTG
CAGAGATGATGCAGTCAAGGTCACGAGCGACTTCGAGCTATCGGCCACAGGCTAATGGACAGCAGGAACGCTCGGTGAAGTCAGTGATGGGTTCCGTACG
AGTGTACGCAGAAGATCCCCTACATCAAGATTGGGACGAAATTGTGGAGAAGTTGGTATTTGCTATTAATACTTCTCAGGACAATACGAGGAGGGAAACA
CCGTTCTACCTCGTTCACGGTTGGGATGCGCAGTCGACGTTGAGGGCGATGTCGTCATCACTCAAACGAGGATTCGGCAAGCAGTCTGACGCACTGGCGT
GGCGACGCGAAATCAATCGACAATACGAGATCGCCCTCGGTATGGCCGAAGCTTATCAGGCTGTAGAGAAGGAGCGACGGGCTAAAAAACATAATGATGC
CCTGAGTCGACTGGAAAAGGCTGCTGTACCTCAACCAAGTGGAAACGAACACTCGATGGACCCTCCAGAAGCTTCAGAAGAGACATATGATCCTGTAGGA
GCCCCCACCGAGATCTCTTTTTGAGATTGGGAGCCGGGTGTGGCTGTACATGGAACGCGTCAAACCGGGCTTGACGAAGAAGCTAGCTCATCGGTGGCAT
GGACCTTTTCGGATCAAGCGCAAGGTGGAAGAGTTTGCGTACGAGCTGGAACTACCAGACCGAAGTGGGTATCGCTTCTACCCAGTAGTGCATGTGCCGA
GACTCAAGGCTGTCAACGAATTCAACAGTCGTCCGAATACTCGGTTGGTACTAGACGCGACTAATGAAGCAAGACTCGATTTCGACGAGGGGCTGTTGCC
TGAAGACAGCTGGGAGCCAGATCAGGTTGCCGGTGAATATGAAGTCGAGGCCATCCTCGACGACATAACACCACTGTCGACGAGCACGGAGCGTGCTGTA
CGCGAGTTCAAAGTCAAGTGGGTTGGTTATGAAGATCCAACTTGTGAACCATCATCCAACTTGTCATGTG