Description :
From Genome Similarity Track
Location :
scaffold_1440:2555- 4639
Sequence
2084 bases(100 bases per row)
CAAGTTCAACATAAGACCAACAAGTACGCTGTGGTAAACAACATACGGATGGCAACACCGTTCACGCTCGACGAGTTGATGATCTTTCTGGGCATTCTCT
TCTTCATAGCCATAAATGACGAGGCGAATACGCTAATTACTGAGGTCTAAAAGCCGAAGGTGCGAGGTTTGGTGGCGTTTCCACGTCGCTGGACGGCATT
GTGACCCTCCATCGATTCAACCTACTGCGTCGTAGTCTGAGCTTCAATGCTACTACTAGTACACTTGACTAAGATGCAGCAACTCGCATCTGGCCACTCC
TTAACTTGCTAAAAATTACCGGAGGCCAATAAATTTACGTAGTGCGAGATGTTTCTCTCGGTGAAGCCGGTGTCGCGTGCCGCTCGCGACAAGGCCACCA
CATGATTGTCTATAATCCCATGAAGCCGACAGGGAAGTATCATTTCCGTCTCTACATGATGTGCTGTTCTACGACTTGGGTTGCGTTGAAGTACAAGCTT
CACTGCAATCGGAGTGACGTATTGGATCGATTGAGTGGTGTGGTTGATCAAGTTGAAGCGTAAACCCTGAGAGAGGAGCTGGAAGAGGTGTCAAAAATCC
GACATCATGTATTGGAGGTGACAAGATCACTGTTTGGAACGAACCACATTGTCAACATGGACAATTACTATACTTCGGTTCAGCTACTTCAGGAGCTTTG
ACTGAAGAGTCTCTACGGACGAGGCACTATCCGTGCAAACAGCAAGCATACCCAGCCCATACTATCTTACCCAAGGATGTCTGTACTATCGCCAGACGAT
TACAGTATACTGACAGTATCGTGGTGCGACGGAAAGGTTGTCAATCTGGCCTCAAATGCTGACTCGACGAAAAATACATACGTATATCGTGTGGTTGGCG
GCGAGGTACAGCTATGTCCAGATAGCTGTACCAACATGCAAGGCGTGGATAGGCTGGAACAAATACGAAGACGATTTTGCCACTGCGGAAGGACATTCTT
ACAAACGCTGGTACAAGAAGTTAGCCCTCGTGTTGATCAATGTGGCAAGATCGAATGCATATCTGACGCGGCGGTTAGTAAAGACAGGGCCGACGCCACG
CGATCTGCATAGAAATTTCGTGATGGAGCTAGTAGGAGAACTTATGAACGGTCAATGGAGGAACGCACCCAGTGACGACCGCATGCTTTACAGTGGAGAG
ATAGTTGATGATGGAGAAGTGGAGATGGCTAGCACGCCTTCATCTCGGCTGCCTGCAGGTAACACAACTGTGCTTGTGATGATTGCGTGCACTTTAGTGT
CGTCCAGACAAATTCACGCGGAGAAGAGCAAAAAGCGTCGCCGTTGTATCGTATGTAGATGGGAGGGGAGATATTCGACGGAAGCAACAAACTATTGCCT
AACACACGGTGTGTGTCTGTGCTGGATTGTACACGACCGCCTCGCCACACCAAGGATGTGACTTCAACATGCTGGGATAAGTTCCAGCTCTACCATCCCA
ACCATTTTTTTACTGATAAAGGTAATGTGTGGCGTCACTCCAAGCTTGCCAAGTTGAAGGACATGCATGAACCTAGAGGTGAACGCGTACGGTGACCTGC
TGTGGCTCGCGAAATTGCTTACGGAGCCGGTGATGATCCGGTCGCATACAGAGCGGGTAGTGGTGCCGCTCTTGGACTCAGAGGTGAGACGGATCAAGGT
CGCAATGGCGGTTGTTCTCAAGGGCTGGCTGTGTTCGAGCCGGGCAACAGTTCCGTACTCGGACTTGCGTTTAGTGAAACTCCGCCAGCGCTGCTTACGG
GCGCTATCAATCACAATGGCAGCTGAACCATGTAGATTTAGCGTTTCTTACAATATATGTAAATAGGATGACATGTACTTCTATTTGGTGTTCTAGGGCC
CAATACTTGCAGTAGGGCTCTGAGCACGTGGAGCGCTGTCTAGGACAAAACTGCGATGTCGAGACAACCACGCGTGCTATGGGCAATGCGCAGAGCTCTC
GTAAAACCACCAACTGTACATGTTCTTCAAATAGAAATGTGACGATGTGCCCCGGGACACCCGAGCAGACTGACCGAACAAAGA