Description :
From Genome Similarity Track
Location :
contig_60:255480- 274808
Transcript NameFunction/comments
g11197.t1hypothetical protein
g11198.t1XP_002906784.1 2-isopropylmalate synthase [Phytophthora infestans T30-4
g11199.t1hypothetical protein
g11200.t1hypothetical protein
g11201.t1hypothetical protein

Sequence
19328 bases(100 bases per row)
CTAAAAATATATGATATTGCAACCGCCAACACTTCCAAGCGGCAGCACTCAGGCGTTCCACTCGATGAAGCAGCAACAGCATGGTCAGATTCAGATCCTG
CGCGACAGCGCACCAGTGGTGGATCTGGAGAGAGAGCCTCGCACGAATCGGTCGTGGGCCTGGGTCTGCTCTGCACTTGTTAGCAGAGACAAAGGCGAAT
GCAGCGTGCACGTGGTCGAGACGGTGATCGTGGACAAGCAGCAGATCTGGGCTTGGTACTACACGGACGCGGGTGTCGTACGCCGCAAGCCGCAGAGTAA
ACTCTCGCCGGAGCAAGTGCATCGCGCGTTCTTGCAGTTCGCCGATGAAGTCGCTGGTCAAGTTGCCACGTTGGACGATGCGACCCGACCGGTTGCAGCC
TGTTGGTTTGAGAAGAGCGATACACCCGGTGTCGTACCGTTCCTCGCTGCGCCAGACCTCTTGGTATTTTTGAATTCGCTCGGATCCGGTAGTTCATGCA
CTGCTGCCATCAGCACTTTCGTCCGTCCGCGCGGTGAACTAGACCCGGGCTGCTATGCCAACCTTGAGCATGAATTCACGTAAGTAAGTCTTATTGTTTG
CGTGTTGCTGGTAGTTCTGATGCATTGTGCTTCATTTTATTTCCGCAGCCTCCAGAAGAGCGGTCGTGTGCAGGGTAAACTCTTTTGGTTAGCTCTTGGT
GGGCAGCGAATCGCGAGTAAGGACGTAAAGTTGAACACCACCGTTAACGAGTTGGTACAGCACTTCATAAGCTTCATGGAGAAAAACAAGAAATGCCGCG
TGGCTCGCTGCGTCTCGCTTTTCATCGTTGACGAGGGTGGGAAGCTGCAGTTGTGGCGGACATCGACTTGTGAAACCATTTCTGGCGCAGCGGCTTTGCC
TTCTGCACCAACCTTCCCCGACGCGCTAGGGTCGTCGTTTCCAAGCACTTACGAGGGACCACGTGCCATGAACGAGAGATTACTGGCTCGAGCCCGTGCT
GAAGGCAGGGGTCCTGATGAACGGCTTGTTGAAGCTATCATGGCGACCGCAGCACCTCACCTCAACAGAATTACGTCGCGGTTGCTGCCAGCAGCATCTT
CCAGTACACGTTTGGACCCGCTTGGAGAATCGGAAGGCAGACGTCGAGCAAACCTCCAGCTTCACAGTTCGACGGACTGGGATGAAGCCTTGTCTTTTCT
TCCAGCTACGTCTTCTCTATCTCGAGGGCGACGACGAACAGTGTCGGCAGCTCATCTCATGTCCAGCCAGAAGCGTGGTTGCTGCGGAGACTTTTGCAGC
ATGTCAATCGCCGAGTTGACTGCTCGGCGTTTGGAACGCAAAAAGGAGCCCACGTTAAGCGAGCAAGCAGGCCACGCTAGGAAAGGCCGGCGACGGACTA
GTGTCGCCACCGCCGCGGCTGTTGCAAGTGCCTTCATGGAGTCCCGTCGCACGAACGACTTGCTGTTTCGGTTAGCAGAGCAACGCAAACCATCGTCGCC
ACAGCGACTGCAGCGTGCCGAGACACAGCAGCCTCAGCCACCAACGCACACCATTCCGTTTAAGCTGGTCGCACAGACTCGGGCTGAGAAACAACTTGTA
GATCTCTTCGTTCGACGGTACCAGAGTGGTGAAGATGGCGACTATCTTGCAGAAGCCTACTACGGAGATGGCGAACCTCTCGGAGTCACGTTTCCGGGAT
ACTATTACCGAGACGTCCAGGTCTGCGCCAACTGCTATGAGTTTTACACACTCGTTGAAAAGGTCCGCATGAAGGCTCTGGATCAAATCGCGCGACGTGG
AGAGAAGAAAACTAGTCCAAACCGCCGAAGTCCAGACAAACAGGATGAAAAACGTACTCGAGAGCTTTCGATAGCCGAGCGAAGAGAGGAGACTGACGAC
GATGGCAATAATGATGTGGAGTATTCAGACACTTTGCAGCATGTGTGGAAGCAAGTGTGGGCGCAAACTTCCGTCGTGGCCGCAGCGATCACGAAAAAAG
ACGCCGCTGAGCTGTACAGCTTTGTAAATCCGCATCCTGCTGTTGCGATGGTGTTGAGTGGTCTGGGGGCTTTGCTTCTGGGGTCACGTGGAGGAGACTG
GGGTGAGGTCAAACGGGTGATCTCACAGGATAAACTCCTCTCGCGGTTGCATCGCGTGGATCTAGAGGGACTGTCTGAACGTGCCGTGATGCAGGCAGCA
GCTCATGCTCGTAATCCACTGTTCACACCGGCACAGATCGCGCCTATTAGTTCATGCGCTGCGAAGTTCTGCGATTGGATCCGTACTGTGCTGCAGGCTT
ACGCGTGGAAGCACAGGCTGCATATGCAAGACACGGGGACACGACGTATGCTTTGCCTCCTCAAATCAGAGATCCTGCCAGCCGGCATTGCTGCTGCTCA
GCTGGAAGACGCGCAACGCGAAAATGGGAAAGTCAAGAAGGTCACAAACGATTCAAACAACGATGATTCGTCACCTACAACGCGGCGCCAGTCTCAGCAG
AAGCAAACTGCTCGACGAGCCATACAAGCTCAGAACATGACACGCCTTGCAGCACCGTCGGGGCTACAAGATGGCGTAGGAGGCGGCACTGCAGATCCTG
TATTTACCTGTCAGGATGGAGTCACGCAGATACCGTACGCAATAATTGGCCAGCCCATCGGTCCAACCGTCAAGTGCAATCTCGTAGTGTTTCACGATTT
GTTCGACACGCTCGAAAGCACTCGAGTGTTCTTCCGACCGATTGTGGCGCGGAACGCGGGCTCACGAGCGCTGCTGTTCAATTTCCCAGGTCAAGCCGGC
TCTGCTTATGCAGTCGATGATCAAGCCCGCGAAGAAGACAAGCTTGTCTTGAACAACATGTGGCTTGCGCGCCGTGTGCACGAGCTACTCAATTTCTTGC
AGCACACCGCCCAGTTCGTCACCTCGGGTGCTCCTTTTCACATCGTCGGGTTCGGAAATGGTGCCAACGTAGCCTCGTGCTACGCCGTACTCCATGGCAA
AAGCTACGACGGATACTTGCAGTCACTTGCTCTTTTCAATGGGTTTGCGAGCGTGGATGCTCAGCTAGCCGCGGTGCTGCACAGCGCAGTGAATGTGTTT
GCATGTTTGCCACCGACGCGACCAGACTTGCCAGTGTCATTCTTCTGTAAGTTTCTCTTTTCAGAGGCGTACTTGTGCAAGGTCGACATGAACTTAGCGC
TGAGTATCTACACAGCTGTGACCAACGCCATCACGCTTGACGGGCGTATTCGCTTATGCCGAGGTGCTCTCCGTCACGCAGACCTGGGCTCATTGCTTGC
CGAGATTGACGTTCCACTTGTCCTAGTGCAGTCAGTGGAAAACACACTGGTGTCCCCCACGAACGTAGATCCATTTCTCCAGGGACGCGCAAGTGTGCAG
CATGTATGGTCCCATCAACAACCGCATACCAGTGACCTGCGCTCTAAAACCCGTGCGCAGATGAGGAAAGCACTAGCAACTCCAAAGAGTGCCTTTGTAT
CATGGCTTCGCGCTGGCCATGAGCTCCGCCAGGAAGCAAAGAGCTACGTCACAGAGGTGATCGAGATGCTAGTCAACTCCCAAACGGAGCGTTCAGAACA
AGATCGCGCGCTACAGAGGAAGCAGACGCGCGCCAAGCAACACCGACGAAGCAGCAAAAGGCAGCAGCAAGAAAGGAGACGACAGTTCCGGATGAGAGCC
AACGTGTCCAGCCGTCACTAACTGATCTCGAGCCTCAAAGTGCTGCAATAACATCCAAAACTCCAGCTGAGCCCTTAGTTGCAGATCCAGCAGGCAATTC
GCTTCTCGTAAGCTGGTCACCACAGCAAACCAACAAATCGCCGTATGACCTTCAACTAGAAAAGTCCGAACGAGCATTTCAGGAGGCACTGCGTACGCAC
GAAGCCCAGAAATCTGCGTACGAGAAGAAGAAGCTCCTGCAACAACCAGGCGCAACGCTGACCACCTCGACAACTGAGATCGCCGAAATCCCAATAACTC
AATCTGTTGTGCCCTTGGACATGCTGCTTCCTCCTGCTCTTCCTGCTATCGTGATGCATGAAAATGATCAAACGTCATGTCCGAACGAAGACAATAGCGA
TACCCAGCTAGATGACGATATCGATGATGTACGTACCAAAATCCGTGCTGAAGAAGTACGACTTGAAAAGGAGGTCGAAGAACAGCGTGAAAAGCATCGC
GCTGCTACTGAGCAACGGATGGCTGCTCTCAGAGAGGAACAGGAGCGGAGGCGACGTGAGTGGGAACAGGAGGATCGCGAGCGACTTGCAGCTCTTGAAG
CACAACTACAGGCTCAACAAGATGAGCGGCTTGCTGAATCTCAGCAGCGGGACCTAGACCAGCTCGCGATGGACGAGGCAGTGCTTGCTGCCGCCAGTAC
AGTCTTAGAAACATCAGTGTCCTCACCATCGCTGATTCTTGAGACGTCTGTCGAAATGCCAATTTCACCAAAACAATCCGCTAGTACGTTGCTGGCTCCT
TCCGTGGAGAAAACACGACAACAGATTCAAGTACAACCAGAACTACCGAGTATGTTTGACCAGCTTGAAGCAGAAGAACACGCTCGGAGACGCCGAGAGC
AGAAACGACGAGCCTTTGGGCCTGGACAGACAGCAGGAAGCCACCTAACCGGCGATCAGTACGACGAGGTACGGACTTCACTAAAGGAGGCCTTCCGAGA
AGATATCCGAGCGAATGAGTCCAACATGAAGCGCGAGTTGCGACGACGGCGTGACGCACAAGCCACACGAGTCCAAAAGTACATCCGCCGGTTCTTGGCT
ACGCGTCGAGTTGATCGTATACGACGTGAAACCCAACAAGAGCGCGTCAAAAACTTTGCTGGTGGTGAAGTCGTGAGGATAGCACGGGGCCGCTTAGGCC
GTAGACGATATCGTAGACTGTTTGAAGAGAAGGAAGAGGCTGCAAGGCGATTACATGCAACCATACGCATCCAGACCGTCTTCCGAGGCTTTTCGAATCG
CAAGGCATACCGTGCAAAACTCCGAGAAAATAAGGCGTGCATGTTAGAGCGAGTTTTTCGTGGTCACCTCGGACGGAAGCGTGCCCGGCGACTGCGCAAA
GAGCAAGAACGCCGCCGCTTTCAGGACCGTAACGCTGCCAAAGTGCAGGCTACCTGGCGGATGTACATCGCGCGTGGCAGATTTCTCACTGCTCGGTTCT
CCGAGCTTGCAGCTCTTGAGATTCAGCGGATGTATCGTGGTCTTCTGGGTCGACGAGAAGCTGCACGCAAGAAGCAGTGGCGCGATGCACCGCCTGGAGC
TGAAAGACTGGCGCTCGGACTTCAACTAATTGAAGGCTCGAAGCAGGCTTTTGAACGACAGCAGAGCGAGCTTGATGCGCTTCATCGCGCACAAGAAGCA
GCCGAGCGTCAGGTTAGTGCTGTGCACAACGAGCTGCGTGAAGCCGAAAAGGAGCTGGCTGTGCTGGAGAACGAACTGCAAGAAATCGACCAGCTAGACG
CCGACGTGAGAGAACTCACACACGAAGCCGAACGACTGCACGCTGGCGGTGTCGAAGGATTGCTACGCAACCACCGATCATCGTTGCAACATCAACCTCT
TGGAAACGGTGTACCGGATACGTCTTCACCACCAGACAGCAACGACCGTGCACCATACCAGCTTGGGGATGAGAACGCGCTGGAGTCGAGGGAGGCCCTG
AAAAAGCGCCAGGCAGACGCGTACGCCGTGGAAATGGCACTCAGCATCAAACGCAGCGAGCGTGAAAAGAAGAAGCGTGACCTGGAAGCGGAGTTTGCTG
GAGCGTTTGCTGAGGTGCAACGAAAGCGAGATGCATTGGCTGCACTGGAAGAGCGGCTTGCTGACATGGAGCAGACTCGCATGCGAAAGGATCGTGAATT
TGCACGTTTGCAGCGGCATCTGATGGAGTTGCTGGAAGAGCAAAAGCTGGAGCTTGAAAACTTGCGCGAAAGGGGTATTGAGCTCGAGACAGCTACAGCC
ACCTCGGCAGCAGCGGCAGCAGCAACGGCAGCTAAAGCTCGCGAGCACGAAGTACGGTCGCAGGCAATGTTTGAATCCACGGAAGAGCTCATGAAGTTCC
AGTTCATGTCGATGTCGTTGTCGTACTTCAGTTCGCTCAATATGCTCAAGAATCTGCGCGACATCAACGCCGACACCACTGCTTCAGCCATCACTTCCAC
AGCGGAGACCGCAGCCACTGCTGCTGCTGCTGCGGCTGCCGCAAACATTACTCCAGTCACCGCAGCTCTCGCGAAGAAGACGCCAGGTGGAGATGCCATC
AGCAATTTACTAACGACTGTGGCGCAGCGCAAGCAGCAAGAGCTGGTGCAGCGACAACGCGAAGAGGAAGAGGCCTTAGCACCAGGAAAGCAGCAGCCGT
TGCCTGAAGAACTACGCGCGTGGACCGTGGGCGATGTTGGTAGGTGGCTCGACAGTTTGTCATTACCGCAGTACAAGGCTGCGTTCAGCGAAGGCGCAGT
GGACGGCGAGTTCCTCATTGAGCTCCGTGCTGAGGACATGGCTGAAGTTCTCGGCGTCTCGCACAAACTCCATGTGCGCAAACTGCTGACAGCACGCAAC
AAGTTGCTGCCTCTGACGGCGGCGGAGCGGTCTCAACTAGATGCCGTGAACCACGAGGCAAATGCTGCACGTGCACGTGGACAGGAACCGGCAGCAGGAG
ATGAAGCCTCGCTGGAGGTGGACACCGTATTCTCGCAGGCGCGCAACGGGCGGATGAAGCGGCTTGTCGAGAGTCTGGACGCAGGCTTCCCTGTCGACAG
CGAGGACGACAAGGGTAACACGCTGCTGCTGCTCGCGTGTCAAAACGTGAACCAGCGCATGGTAGAGCTCCTGGTTACACGCAGAGCCAACTTGAATCAC
CGCAATGCACAGGGCAACACACCACTTCACTTCGCGATGGCCTACGACGGTGAAGGTGTCCTTGGCGAGTACCTGATCGCACACGGCGCCGACGACACCA
TCGAAAACAACAGCGGCCTCACAGCCTACGACGGGCTCACAGCGGAGTAAATGGCGTATCAATCACACAGGACAAGTTGCTAGAGACATTCGTGCCAGCT
CGCATCGTTTGCGAACTCGGGACACTATATTTTTGCTTTCCATTCTGCTGGTGTACCAATGAAGCCTTCCGCAATGCGCACGGCGATTAGATAATACATA
CTACAGCACTCGCTTCCACAACCGACTTTCTCCCTGCTCCAACAATGCCTTGCAGTGCTCCACGATCGCTTGGCGAGCCCCTTGTTACTTTGATGCTGTA
TTCTCGTAATCTTAGGCGTCCACCCGAGCCTCAGTCACACCACGCACCTGGGAGGCCATCATACGGTTAACGGCGTTGACGTAGGCCGTAGCCGACGCTA
CCAGGATGTCAGTGTTGGCGCCGTGGCCAACGAACTGGCGGTCACGTGTCACACCGGTCTGGGCGTTCACGTGCTTCTCATCTTCCGTCTTCTCCTCCTC
CTCCTTGTCCTCCTGCACTCGCACGGTCACCTCACCCAGAGCGTACGTGCCATCCGTCACACTCTCCACGGAGAAGTCATTCAGCTTGATGCTGTCCATG
CCCGTAGCGCGCTTGATGGCCACGTAGATGGCGTCAATGGGACCAGTGCCCATGGCAGCCTCGCTCACCTCCTGTCCATCCTTGTGCGCAAGCGTGACCG
TAGCCGTGGGCTTGACAAGGTTGCCAGCCGTCACATGCACGGACTGCAGCGTCCAGAACACCTCGGGCTTGAACAGCTCGTCCGACACAATCGCCTCCAT
GTCAGCATCCGTGACCGTCTTCTTCTCGTCAGCCAGCACTTTGAACTTCTCCACGTAGTGGTCGAGCTCCTCCGGCGTGAGGTTGTTGTAGCCAAGCTGC
TGGAGACGCTTGCTGTACGCGTGGCGGCCCGAGTGCTTGCCGAGCACCATCTTGTTCTCGCTTAGACCCACCGACTCCGGCAGCATGATCTCATACGTGG
CTTGGTGCTTCAACACTCCATCCTGGTGGATACCAGACTCGTGCGCGAAAGCGTTAGCGCCCACAATGGCCTTGTTGGGCTGAATAGACATACCGGTGTA
GTGGCTCACCATACGGCTGCAGCGGGTGATCTGCGTCGAGTCCACGCTCGTGTACACGGGGAAGTGCTGCGGGCGCGTCTTAAGAGCCATAACAAGCTCC
TCGAGGGCCGTGTTACCGGCACGCTCACCGATACCATTGATCGTAACCTCAACTTGACGCGCGCCGCCCTGAACAGCAGCCAGCGTGTTGGCCGTGGCCA
AACCCAGGTCGTTATGGCAGTGCGTGGAGAAAATGGCCTTGTCGCTGCCCTCCGTGTTGTCAATCAGGTAGCTGAAGAGCGATCCGTACTCTCCAGGGAC
CGTGTAGCCGACCGTATCGGGGATGTTGAGCGTCGTGGCGCCAGCCTTGATGACCTCAGCAAGAACGTCGCACAGGAAGTCGGGGTCACTGCGACCGGCG
TCCTCGGTGGAGAACTCGACGTCGTCGGTCAAGCTCCGCGCGAACTTGACGGCGTCCACGGCGCGACGGATGCACTCGTCGCGCGAGATTTTGAGCTTGT
ACTTGAGGTGGATGTCGGACGTGGCCAGGAACGTGTGGATGCGGTGCTTTGGCGCGTGCTTGACAGCATCGTAGCAGCGCTGGATGTCCTTCTCCATGGC
GCGCGCGAGGCCGCACACGGTCATGGGCTCGCCCGTCGCGCGGTTGGCCGTGAGCGGGCCGACCTCTTTGGCGATGGCCGACACGGCTTCGAAGTCGCCG
GGCGACGAGATGGGGAAGCCCGCCTCGCACACGTCCACGCCCAGCACGCTCAGACTGCGCGCGATGTCAAGCTTTTCCTTGAAGTTAAGCGTGGCGCCGG
GCGACTGCTCGCCGTCGCGCAGCGTTGTGTCGAAGATCACGAGGCGCTCCTTGCCGGCCTCGGCGGCGGCCACATTCGAGAAGGCGCGGCTCGCGTTGGC
TCGGGCCGCGGAGGCCGAGCGCTTGGCGATCGACTGCATCATGTTGGTGTGTACGGGAGGAGGTCAATGGGCGGAGCAAAAGTGCACGTCACTGCTGCGC
TGCGGATTGCGGAATGAGCCGCAAAAGTGCAACCAGCCGCTCCGGTTTGAGCAAACACGCGTACAGAGGTTGAGCGGCTGCATCAGCTCCAGGCAATTAG
ATGCACCACCAGCAACGGCGCGACCGCGATCTTAGCAGGGCCTTTTGACCAATCGTATTGCGCACAACAGACTTTTGGCCAATGGTAGGGATGCGTAAAA
ATGACGTAAAAAGTCATGCGTGGCGTAAAAAAAAAGAGGTAAAAATCTCTTGGCGTGCAGGCCAGTCGCGCTGTCCCGGTGCTCAAGCGCGAGCGGTCAT
ACTGTATCATCAGCACTTCACCACAAGAACGTGCGCGAGGCGCCCCAAAAGTTCAATGCCGCGCGCCTCCAACACGATCATCAATATGTTCAATCTGCTC
GGCAGTTTATTCAACCTGCTCGGCAGTTCAACATGAGCGGCGGTCATGCGCGGTTCGACAGATCCCAGCAGCGACTTCAGGGCATGGACAAAATCACCTT
GGACATTAACTCCTGCTTTGCTGCAGTGCCTGCACCTGGTGGCTGCAACGCTATCACATCTCCATACCTTATCAATGGTCTGCTGCGGCTCATGGCCGAG
CACAAGCAGCGAATGAGCTTGTGGCGTCCAATCCGAGGGCCGGTGCAGCCGTCCTTTCCTTGAGGTCTCATCAGATGTTCACCTTCAACCTGGCCTTGAA
CTCAAACAGCGCGTCAAGGTGGCAGTGCTTGCAGTGGCTCTCAGCCCAGTGAGCTGAGCTCACATGGAAGGACGGCTCGCATCGGAGCACCAGACTGCGG
TGCTGAGGCTCCGATCGAACGTCTTTGATGTAGATGTACCGTCAAGGTGGTACCGGAGACGACTCTTCATTGGCTGATTATCGCATTGACCGTTACGCCG
CAGTGCGCCATGTCCTCGCCAAAAGCATAATCGTCGTGGAGCCCGTGGTCTTGGAGACCAGTTCCGCTCCGGATGGCGTCTCGGCCGCTCGAAATGCCCT
CGGGGCGCATCGCCGCCCGCCCCCCAATGCGGCAGAACGTGGCTCTGCGTTGGGTGAACGCGGTTGTGCCAGCTTCGGCCGCATCCAAGACCTCGCCTTC
GCCCATAAAGAGATGGCCTCCCCCGTCGAATGTTGAAGCCCCGCCTCATGCTCCAGTGATTGCAACATCGATGCCAGCGCCTGCAGTGGAGAAGAAGAAG
CCGGTGTCTGCGGGATTTCAGTCTGCGCGCGCCGTGTTCGAAGCCAAGAGAACTACAACTAACCCGCCGCCAACTCGTCGCCGATTGCCGTTCCCCGCCC
CACCTGCGCCTGCAGTTGTGAAACAGCACTCGGTAGCATCGGATTTGTCCAGCTCTTCATGCAGCACGGTAGACTCCGAGAGCAGCCGCATACTGGAAGA
AACCATGGAAGCGCAGCATGAATTCATGACACGGTCGCCGGTTCGGCCAAGCGAGGCAAAAAAAGTGGAAAAGAAGTCCTTGACGATCACCTCTTCTGTT
ACCGCAGCAGGCCCTGTACCGCGATCACCGCTTCCAATTAAACAAGCCGCTAGCTCTCACATACCTGCATTGCTGATGACAACATCCGCGCAGGCGAAGC
AAGGACAGCCCAGTATTAATGCCACCATTGATCCATTCCAACTTCTTCTTCCAGTTGGAGCGGTACCAACACTTCCCGATGAAGTGTCATGCGTCTATGA
CAACGCTGCGATTGAAATGCAGAAGGGCGTCAAGAAAGTAGTGCGCAAGCTGCTCAAGAAAAACAAGGCACGGCAAGAGGAGTTCAAGGTCAATTCCCGG
CTCTTTGGAACCGATTTCATGGACTCGCAAGCTTATCTGGACACGCTGATCAAGGACTTTGGCGCAATTCGTGCCCTGCAACTTGTTCCGTGCTTGTTGA
GCATCCAGCCCGATATTCTGAAGAGCAAGGCTCTCCTTCTTACCGCCAAAAACTATCTATTGCGAAACGAAGAGTCATTGGAGTGTGAGCTGCGGGCCTT
GACGGCACCAAGTACCAGAGATAGTGCTAAGACTGATGGCGTATCAGTTGTTGGCTCTGTGGCCATCCCGCTCCCAGACGCTGAGGTGAAGACTCTATCG
CCAATTATCAGAACTGCGTTGAAGGTGCCTGCACACGCCTTGGCGGCGGGACCTCAGTCGAGAGAAGAGGTCAACTCCACGGCTACAGTCTGCACCTCTA
TGCCTGACCATGTCGATACTGTCGATAGTGCTGCCGGCAAGAACGATTCTGCAGTGTTGCCAATTTCGGCTTCTAAAGACATAGTTTCGGCTACCATTTT
GGCGCTGAAAAAACCGGAGTTCACTAGCCCACCAGGAGGAGTATCACCAGCGACCACTATCCAGTTGGCTGAACCCATGCCAGAACCTCAAGAGGCAGCA
CTAATTGGGCCACCGCCCCATGTGACCAATATTGTGGTGAATGCTCCCACGCCGGCGACGACTACAGCGGTGCGCGGGATTGATGCCAATCCAGTTATCA
AGAAGACTCCGAGTCGGATACTCCAAGCGACAGTGGGGATGAATTTCGTGCCGAAAATCTCTTCGGCGAGCCTATCAATCCTACTTCTCCGCAGCAACAG
CAGGAAGTAGCTGCCATCTCCCCGGTGTCGTCGACGCACAGTTTCGACGAAGCGGAGAGCTTGTTCGGTGAGCGTCTGTCCTGCTCGTCTCGCTCCAGCA
CGAGCCGGCGAAAGACTGTAACATGGGGCGAGGCCAAAACAATGGAGGTCCCCGTACAGCGAGCCTCATGCATCAACAAGAAGCCGCCCCGCTTATTTTC
GGCCTTGCCACCGCAGGCGCCTTCGACTCGGACTCGGACGACTCAGACGTGGCCTGAAAATGAAACATACTCAAGTGTAAAGCATTGTGTCGTTTTGCCT
TGTCGAGGCAACGCAGCTTGCACCGACATGACAGAACGTAGTTTCACATATTCTAGCACACAGGTTGAGGTTCACAATCCCTCGACAAGCAAGATGTCTT
CGCCTCAAATGCAGCCGCGGCAGCGGCCTAGCAGCGCCGCGAGCCTCCACGGCGACTTCCGGGTGGAAGTGCTGGGCAGCCAGGAGTCTCTGGACCTGGA
CTGCGGCAAATTTTACACGGCAAGTAGTGTGTGTTGGCCGCTGTAGCCACGGTCTCCCCAGTCTCACCTTGTACGGCTGCAGGAATACATCCTGCGCTGC
TCGTGGATCGAGCGCAATGGGACGCCAGAGGTTCGTTGAGCAGCAGCTTCATTTGCATGGCATTGAAAACAGGAGACTGAATTGGGCGACGCTGGTGCAC
AGATTTGGGACGTCGTGCGACGGTACCGCGAATTTTGCGCAGTCGACATTTTGGTGAGAAACAAGGAGCAGTCCACGCATTCGTCACGTTATACGGCTAA
CAATGTATGCAATACCTATTGTGTGTATTTGCAGCTGCGCGAAAAGTATCCGTCGCGGGCGCCCATGTTCCCGTATCTGCCGAGCAAGAAGTACATCGGG
TCGTCCCTGTCGGCCGACTTTGTGGACAAGCGGCAGCGCGACCTCGGCTACTACATGATGTCCATCCTGCACAGCTGCCCGCTGGTACGCACGTGCTGAA
TTCTATACGCCTGATGCTCTTATTACCCGCCTATTGACACGATTTGGTGTTGGTAGCTCGTTCAAGACGAGATCATTGACTCGTTCCTGGACATTAAGCG
GCACATTTTGGAGCGCGCGCGGGAGGAGTTTAACGACAGCCGCTTGGCTTCTACCCCCACGCACACGACGAGCAGCAACGGCGGCATGAGCCCTGCACGG
CTGCAGCTCTAGTTCCATCAATTCAAATACACTTATTACTTTTGACCAGATCAAGTCTCGTCCCCTCGCTCAAACAGCAATTTGCCGAGAGAAGGAAACG
AGTATACAAAGCCCCATACAAACCATAACCCCCTCTTTAATCCGATATGGACCATCACTCTGCGCAAGATTTAGTGGCTGCACGCACAGCAGAGCGAGCT
CCGGACCGGCCTAAACGTGGCGCGGCGCGAGTAAGTTTGGAGCGTGTTCGTTACCAGTCCCCGCGCGAGTGTACGAGCGCTTCCAGTGGACGAGAGCACA
GCCGCGTCAGGGGAAAAGGGGAGAACATGGCGCTCGCAGACATCATGTCGGTGGAGATGAGTGCCAAATACATGGACTCTAGCAGCTCATCGAGTCTGTC
GTCGGACTCGGACGACGTGTTGTCGTCCTCGAGCTCTTCGGCCGTCTCGTCGTCGAACTCGGAGTCGGACTCGGACGCGCCGCGAGCGTCGGCCAAGAAG
AAGAAAGCAGCAGGTCCTCGAGGACGCGCTGGGAAGAAGGTGGACGTGGCGCTCTCGGACTATGAGGACGACTCGGACTTGGACAGTGCCACTAGTGGAG
GCAGCAAGAGGAGGAAGAAGAAGAAACCTGCAGCACCCAGACGGTCGCCGGTCAAGAGCAACGGGAAAGCCAAGAAGGCGGAGAAAGCGGCTCCTGTAGT
AGCGGCGCCGCCGAGTCTTCCACCCCCACCTCCGCCTCCGTCGCCTCCTCCGGCTGCACCAGATGAGGAATCTTCCAGTAACAGCTCATTCAGCTCCAGT
TCCAGCTCGGACTCGTCGGAACTGTCGGACTCGGAGACAGCGCTCCCCGTTCCCCCGCCACTCCCACCTGCGGCTGGTGACGCTTCTCCTGCAGTGTCTG
CGGCTGCGAGACCGCCGAAGCGGAGAGCTTCGACCAAAAAGAAGGCGGAAGTGAGTCCGTCGTCGCTGAAGGTGACGCTGAAGCTCCCGCCAGGCTTTAT
TGCAAAAGGCGGGGGAGCACCTGCAGCTAGTAGTCGAGCTCAGGTGAACGCCCAGGCGACAGACACGATACCTAAACGACCACGAACGCCCACAGCTACA
GCAAAGGCTGCAACAAGTTTGCGGTCTGCCAAGAAGAAACAGCCAGCAGGTCGTGCCCAGAATTCTGTTGTCCAAGCGAATGGGACGTCCCCCGCAGTAC
CGCTCGTTCCGGTTAGTCCTCCCGTTTTGCCCAAGCTGATCCCCACTGGTCCGACGGTCCCTTCAGGCGAGGTCCGAGGTGCGAAAGAGCTCTCGCTTGT
GGACCCGGCCCTTGCCAGAGACAGACCCGAAGAAATTATTGAGTCGAATATCCCGGCACACTTCAACGACGCTTACGCTCATGGAGGCGATACGCTGCGC
CTTTTGGACATGTTCTTTTTCTGCGATGAAAACGGGTATGGCGAAGCCTCACTCTTTGTTGGATGGAAGATGAATTCTAATATCGTTGTTTTCCTCGTGC
CGCTTGTTTCTACAGCAAGGCTATTAGTCTCGAGATTTTAGACCGACCAAAAGATCAGCGCCCAAAAATCATGGGGTTTGGAACACTCGTAGAGCATTTG
CCACTAGCGGAGCGTCCGCTTCCAATTCGGCCTATTCTTGCGTCCCCAGCATTTCCCTCGCGCTCCAAGAAACGCCCACGCGCGGATTCCGCCTCGTCGA
CCCCTGCAAAATCCCCATCCGCTAAAGCAAGAGCGAGGCCCAACAGAGGTAAACTGTCGTTGTTGCTGCTGTGTGTCGAACTGGTAATGCGGTTTTGCTT
ATTGTTTGCCATGTCCTAGCAGGAGCCAAACAAAATGACAGCAAACGCCCAAAAATTGAGGATGAAGCCATTTATCAAGGCGATGGTGAATTCGAAGACA
AGAGAGAGAGGTTGCTCATGCAGCAGATTCCTGCATTTTCCAACGGTCGACCGTCTATCGCTTTCCTAGCCCGTTTTACCCGAATCAATTGTCTCAAATG
GATGGACAATCCGATTCGGATAGTGGTGGTAGCGATTTGACTTCAGACGACGAGGATATTCGTTCTGGCCGAAGTGGATCTGGAGCTGGCTCCGAGAACG
ACAGTGAGCTCCTCTCGTCCGCCACCAGCAGTTCGAGTGGTAGCGGTAGCGACAACGAAGTAAACTCGGGCAATTCTTCGTCATCATCCACTGGTAGTGG
TGCTGAGAGCGGAAATGGTACGACGACAGCGAGTCGGCGCTCGTCGGCTACTACCGGCAACCCGGCGGTCATTAAGGCCGACCACTTTCCACAACGAATT
GCTGAACCAGCAAGACCTCCAATTAACAAAGTGCAGAGGCGACCGAGCACCAGCGTGGATTCCAGAAACGCGGGCTTGCCGGCTGATGTAGTCGGACTTA
TGCGAACTGACCAAGCCGTTGACGTCAATGCAAAGGGCACTCCAGATGAGCTTAATTTGATGGAGTGCGGTTTCAGACACCCGTCTAGCTACGCTCGCAC
TCGCGTTTGGCTTCCTGAGATCACGGATTGGTGCCTGGACTACGCTGAGGGGGACCCAACACTGTGGGTTGTCACGCCTCATTCCTGGTACAAGATTGCA
GGCCCGCTGTCTGGACTGCTACCTCACTCATCGTACCGTCATACTTTCAAGCATGTTCGTCATCTCTTTGAGGCAAGCTACCTTGTGGCGTACGTTCTAA
AAGAATGGCTGCCGATTAACAAGAAAGTGTCCTATCGAGCCACTCTCCAGCAGATTATTGAGCTGTCTTTAAAGGGCAGATTTCGAGTGGTACGACTGCA
TACTGCATTATGTTGGTGGTGTGAGGATCATGACTTATCGTTGTCTAACGTTGGTGTTGTTGATAACACGTGTGTTTGTAGTCTGCGTGGTTTCTTGTGA
AGAATTACCCGTTCATTCGAGCCCAGATTTCAAATTTGTTTCCAGACAAGGAAGTGTATCTGGAGTCAATGTTCTTTAAACAGCTGCATCGCCTGCACGA
AAACTACACGCTACGTGAGGCAAGACACCAAAAGGAGATGGCCGAACGAGAGGTTCGACGTGAGAAGCGAGAAAACGAACGCCTTCGGAAGAGACAGCGA
GTTGATGATGCGAGGCAGCGCATGATGGACGAGCGTGAAGAAGAACGAAAACTGAAAGAGCACGGTCAAAAATACCCTGTCGAAGATTTGCGCCTGCTTG
AAGGAGATGCAGTCAACACCAACAGCCTCCCTTTGGCGTGCTCGAGTCTAAAGGGAGTTGAGGGCCCTCTTCTCGGTGAGCTCATCATGGCGTGGCAAAC
GATCAGCACTTTCAAGGATTTTGTGGGGCTTGAATCGATTTCGTTGGAGGCACTTGTGGAGTGCATTACGACTAGTTGCGACGAAGGCACCCATGTGGGA
TTAGCGCGGATTTTTATGGCGTTCCTCCATGTCATCTTGTCGGAAAAGTCGTTTATGTCGCTGCTGGATGATCTTGTTGTTGAAGGTAATATCAAGGTCT
CAGACCTGTTCGTGAACAGTGAAAGGACTTACGGAATTTGCGAGCGTGCCTACGGTGACATGTTGAATGCTGTCACTTGGCAAGAGATTCTCCGTCAATT
GATGTCCAAGGACATGGGAATCGACCCATCTATTGGCCACGCAGAGCCTTTAGTTGGGTGTGAAATCGTCCGGCAGACGCTATACATGCAAACCAACTCG
ACACCATTCAATACTCCTGTTGACACATCCGCCAAGGGCCTAGAGGATTACTTGCAGATCATCAAACACCCAATGGACCTGGGGACTATCAAGAAGCGAA
TTGATTCAGGGGGATATGAGGGGTCCGACGGTTACGAAAAGTTCGCGGGGGATATTAGACTGGTGTGGGATAATGCTGTACTGTACAATGGCGAGGAGTC
AGAAGTAGGGCGCACTGCCTTAGCATTGTCGGACGTCTTCGAACAAGATTACGAGCGTTTCGTGATCGGACGTGTTCGTGCAAACCAAAGCAGGATGGAA
GCGTGCAAGAAGGCTAAAGAAACGCTGCAAGACTCATCAGCAGAGAAGGTCAAGACGTTCAAGTATGCCGACGTTGTGTACGGCCTCTATTGCTTCGAGT
TCCACGAACTTCCGACGCCGTACAAAATTGGTGCTCTTTCGTGGATTTGTTCAGAATTCTTGACCCTTTCTAGCATTCGAACCTACATGGCATCTCAAGT
GGATCAGGAGATGCTGATTCACAGGAATCATAGAAAGCGCGCAGCCGATTTGGACTCACAGAGAAAGCACTCCGACAAGATGCGGCGTGAAAGAGAGAAT
GCCTTTAGAAGAGATTGTGCTAACCAAGGCATCCATCCCAATTCGCACAACGTTTTCTCGGAGGGTATTAAACGCAGGCACGAATTTATCGGCAAATTTT
TCGAAGACATTCAAGCAGAGAAAGCTGAGGACGATAAAAACGTGGAGCAAGAGAAGAAAGTTCAGCAGAAGAAATGGCGAGCGAACTAAGCTCAATTGTT
ATTCGTGAGGCCCCCCTAGGGAGAGACAGATACCACAATTCGTACTATATGTTCAAGCATGATACGAAGCCGCGGTTGTTCATCGAGCGCGGGGATCTGG
AGAGTTCGTGGTTTGTGCCAGCAAAGCTCAGCTTACGACAATTCTGGAGTGGTTAAACCCTAAAGGAGTTCGGGAGCTGGACTTGTTGACGAAACTACAC
GAGGTGAATGATAAGCTACTTAGTGCCTTCGATGAAGAAGAAGGCAAGCAAGACGGAGATACCACCACGGAGTTGGTATGGAATGCTAAGGATGGTATTG
AACTCCAAATGTTCCCTCTTCCGGGTGGCGCTATCAAGAGTGAACAATGACTATTACAGACGCGGACAAGGTCATCAAGTCACACAACGTGACCCGCAAA
ATGTTACTTAGTTTGAAGCAGCATTTAGAGAGCACAAACACGCTGCCTGCTTCTTGGGAAGGTTCTGAGACGTGGAGTGATCGTGTGGAAGAGGCAAAGG
TATTCAAAGAGCAACTCGATCTGTTTGCAAAGCTGGAAAATGCTGCAGTGACAGCCCTGAATTCAGGCGTGGAGACAATCAGACCTTCATGGCAGCGGAA
GCGACATGAGTGGCGGTTGGCACTCGAGGGTTCATGTACATACGCGCAGTTAGTGTTTCTACTGCATCTGCTGTTGGAGGAGTTCATTAATGTGGAGGCT
TTCATGGATCTGCACATCCGACTTGATCGGCGTGAATGGCTTAAGCTTCGACCTAAGGAGACTCGGAACTTTATTCCTGAGTCTGGAAATGTTGTCGTAT
ACTTCGGAGATGGCCATGCCCTGGCGCTAAAAGAAGACGAGAAGAGCAAGAAAAAGCGCTTCACACAGAAAAGTGATACTCCTGTTCGAAATGCAGCAGT
TGTCTGCACGGTGGAGAAGGTATCTTACCACCACGGCGGAGGTGACCCGTATGCGTTGGCGGTATTAAAACCTGTCTCGGACATGGCTCTGCACGAATGC
ATTCGTAAGCCTGGAGAGCTCTTGTGCCCCCTGCCATCGCGAGAACAAAGGCTTGCGAGAGTGTTTCTGCGAGTTTTGGCTAAGCTGAAAATGCTAGCTG
ACGCCGGACCGTTCCTTGAGCCTGTGTCTGATCGGGAGTTTCCACAATACAAGGAAATTATTCCTCAGCCGATGGATCTTGAAAAAATAACCTCCAAGGC
AAGCAAGCTGGAGTACAAGAATGCGGTTGAGTTCATGACTGACCTGAGGCTCATGCGCGATAATTGCCAGCTCTTTTGCGAAGGCCGCTTTCCGACACTG
CCGCCGTTGGCCCACAACTTGGTAAACGTTGCGGATGGACAAATCAAAAAGTGGGGTAAGGAAATTCGTGCGTGCGAAGATAACTTTGATGGCTCGTCAT
CGATGAAGAATAGCAGCACGCTGTCTCCGGAAAAGAAGGACGCTATCAAGCAAGATGAATTAGACGGAGGAAAGACGGAGTTGCCAGCCCGTTCGATCAT
GACAATTTTGCGCCTCGAAAATCGATTGCCCGAATACATTGTGGATATTAGTCGTTACGCGTGGGCGGTGAACCGTACATGGCATTGTGGAGAACACTTT
CGTATGCTGTTCCGCAACCCACAAGGGTACCCAGGCGAGTACTACGGAGGGGTAACCGCAGGGTCCTTGCCATTTGATGATCACGGAATGCTGCCATGGG
AGGCGCTGCGTATTACATGGGACGAAGATGACGGGTCGGACGACAATCGCATTAACCCATGGTTCGTAACTTGGCTGGTGTACAGGATGCGATGTTTGTC
TGATTTCTCACATTATTTAAACTTGTCTGACGAACAGGGAAGCGGAGTTTCCTCGGGGTGGAAATCGGGCGTAGATAGAGATAGATGTTCCAAGCTCTCG
ATTTCGCTTAGGCTGATTAAAGTGCTCA