Description :
From Genome Similarity Track
Location :
Scaffold_115:255471- 259415
Sequence
3944 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATAAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTT
GTATACTCTCGGAAGATAACTTCCTCTTGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCATCGCGGGTAGACTA
CCTGAACCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATTTGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGAAA
TGGAGGCCCTGCAGAGCCTGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCG
GGAGAACCTGCAGGCTCCGGCGGCGGGAGCAAACCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTT
CACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTG
CTAAGAGTTGGGTGTACACGCGGGAAGCGACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTACGAGCCGCGTTCCTCCCGGCGAA
CTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGTAAACAAGGAAGACGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTA
GTGGGAAACCCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCA
CCCTTGAAGAGGCGATTCAAGTGGATCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTAGGCCGGCCTCAGCGTGGCCTGGGAGTTCCTTGTCGACTCC
CGGTCGAACAAGCCCCAGCGGACCTGTTCCCATGGAGCTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAG
CGCGACTGCCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAAAAGCCAGGATCCCGGGGACAGGGGAACGCAG
GGAGCCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTT
CGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGAGATACGATCATCCCTTTAGAGTCTTGATTGACTCTGGGG
CGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGAAGCTTTGCGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCG
ACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGAT
ATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGC
AGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCAGCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGA
GTCGTCGACGTATATGACGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACT
TAGGTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACCGAGTTTCACTCACAGTCGCCCAGACCTTAACTGAAGA
GGAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTG
GGTAACACAGTGCCACACGCGGTCGCCCAGACCTTATCTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAATAGTATCACACGAGGCCACGA
GTGCCTCGGATGTGGTAGCGACGACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGACGTCGGCAAAGACGCCGCCGCCCCCCCAAGTCGGA
TCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACCCGGAGTCCAGGGCCCGGGCTCCTCCGACAATGCCGGTGGAAGAGTGCTATCACATCTTCGAT
GGCGAGACAGGTTTACCCGTCAATGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGCACCTCGAGGCAATGACGGCTGAGTCTT
TCCTGACCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAGCCCCAAGGATCC
GGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTG
CCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAACGCAGGCATGG
TGCGGGAGTCGAAATCCTTGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTAGTACACGCTTATAACAAGCTGAACAACGC
GGCGGCGCTGGACCAGACCAATCTCACGAAAGGATGTGTTGTTGAACAACATGGCCGAAAGCGTACTGTACAGAGCGCTAAATTTGGTAGACGGAAGCTA
CCAGATACTGATTAGCGAGAGCGACATCCTGCTCACCGAAGTGAGCACTCCAAGTGGCATGCTGTGGGAGTGGCTCGTCATGCCACAGGGCTTGTCTAAC
GCTCCGGCGACATTCTACCGCCTGGTGGTCCAGCTGTTCCGGCCATTGCACGCCTTCGTACAAACGTACTTCGACGACATCTTCGTCCATATACGTACGG
AGGGAGGTAAGACGGATATGAAGGTGCACTTGGGGCTTCTCCGTCGAGGGTTGGACGTGATACAAGTGAACAAGCGCTAAGTTAACATCGACAAGTGCGT
CTTCGAGTCACCATAGATCAAGGTTTTAGGCTGCATCGTAAGAAACGTGGGCGTTCGGGCTGACCCAGCCAAGGTCAAGACCATTACCTCATGGCCAACG
CCCTGGTCCCAGAAGGATCTTCAAACGTGGTCGGGCTTGACCAACTACCTTCACAAGAACAACGTAGAGTACGCGGGCTTCGCTAAGCCCTTGTCGAGTC
TCCTTCAAAAAGACGCCGACTTGCGCCGGAGGCAAGAGCACCAGGATACCTTTGACAGCATTAAGGCCAGTCTCCAAGAAGCCCCTGTCACGGCCCTGCC
GGACGAGACGAAGCCATTCAGCGTCGTCTGCGATGTCTCCGACTATGCCATCTGTTGTGCATTGCTGTAGCCCTACACGGCAGGACATGAAGGAGTCATC
TTGTTCCCGTCCAGGCAGCTCAAAGCCGTCGAGCGGAGCTACACTGTCCACGCCAAGGTGTTCCTGGCAATGGAGTATGCCCAAGGTTCGGGTTTACTTC
TGGGCTCTCGGCCCTTTGTGATCTACACAGACCACGCATTCTTGAGGATGGCAACGAATTTGCCTCACCTCTCCCAACGGAAAGCGAGGTGGCTGTCCTT
CTTCGCGGAATACACCTTCCAGGTGAGTACAAGCCGGGCAAGCT