Description :
From Genome Similarity Track
Location :
contig_60:255453- 274781
Transcript NameFunction/comments
g10725.t1POM57668.1 Hypothetical protein PHPALM_37790 [Phytophthora palmivora var. palmivora
g10726.t1XP_002906784.1 2-isopropylmalate synthase [Phytophthora infestans T30-4
g10727.t1ETK83640.1 hypothetical protein L915_11217 [Phytophthora parasitica
g10728.t1hypothetical protein

Sequence
19328 bases(100 bases per row)
CTAAAAATATATGATATTGCAACCGCCAACACTTCCAAGCGGCAGCACTCAGGCGTTCCACTCGATGAAGCAGCAACAGCATGGTCAGATTCAGATCCTG
CGCGACAGCGCACCAGTGGTGGATCTGGAGAGAGAGCCTCGCACGAATCGGTCGTGGGCCTGGGTCTGCTCTGCACTTGTTAGCAGAGACAAAGGCGAAT
GCAGCGTGCACGTGGTCGAGACGGTGATCGTGGACAAGCAGCAGATCTGGGCTTGGTACTACACGGACGCGGGTGTCGTACGCCGCAAGCCGCAGAGTAA
ACTCTCGCCGGAGCAAGTGCATCGCGCGTTCTTGCAGTTCGCCGATGAAGTCGCTGGTCAAGTTGCCACGTTGGACGATGCGACCCGACCGGTTGCAGCC
TGTTGGTTTGAGAAGAGCGATACACCCGGTGTCGTACCGTTCCTCGCTGCGCCAGACCTCTTGGTATTTTTGAATTCGCTCGGATCCGGTAGTTCATGCA
CTGCCGCCATCAGCACTTTCGTCCGTCCGCGCGGTGAACTAGACCCGGGCTGCTATGCCAACCTTGAGCATGAATTCACGTAAGTAAGTCTTATTGTTTG
CGTGTTGCTGGTAGTTCTGATGCATTGTGCTTCATTTTATTTCCGCAGCCTCCAGAAGAGCGGTCGTGTGCAGGGTAAACTCTTTTGGTTAGCTCTTGGT
GGGCAGCGAATCGCGAGTAAGGACGTAAAGTTGAACACCACCGTTAACGAGTTGGTACAGCACTTCATAAGCTTCATGGAGAAAAACAAGAAATGCCGCG
TGGCTCGCTGCGTCTCGCTTTTCATCGTTGACGAGGGTGGGAAGCTGCAGTTGTGGCGGACATCGACTTGTGAAACCATTTCTGGCGCAGCGGCTTTGCC
TTCTGCACCAACCTTCCCCGACGCGCTAGCGTCGTCGTTTCCAAGCACTTACGAGGGACCACGTGCCATGAACGAGAGATTACTGGCTCGAGCCCGTGCT
GAAGGCAGGGGTCCTGATGAACGGCTTGTTGAAGCTATCATGGCGACCGCAGCACCTCACCTCAACAGAATTACGTCGCGGTTGCTGCCAGCAGCATCTT
CCAGTACACGTTTGGACCCGCTTGGAGAATCGGAAGGCAGACGTCGAGCAAACCTCCAGCTTCACAGTTCGACGGACTGGGATGAAGCCTTGTCTTTTCT
TCCAGCTACGTCTTCTCTATCTCGAGGGCGACGACGAACAGTGTCGGCAGCTCATCTCATGTCCAGCCAGAAGCGTGGTTGCTGCGGAGACTTTTGCAGC
ATGTCAATCGCCGAGTTGACTGCTCGGCGTTTGGAACGCAAAAAGGAGCCCACGTTAAGCGAGCAAGCAGGCCACGCTAGGAAAGGCCGGCGACGGACTA
GTGTCGCCACCGCCGCGGCTGCTGCAAGTGCCTTCATGGAGTCCCGTCGCACGAACGACTTGCTGTTTCGGTTAGCAGAGCAACGCAAACCATCGTCGCC
ACAGCGACTGCAGCGTGCCGAGACACAGCAGCCTCAGCCACCAACGCACACCATTCCGTTTAAGCTGGTCGCACAGACTCGGGCTGAGAAACAACTTGTA
GATCTCTTCGTTCGACGGTACCAGAGTGGTGAAGATGGCGACTATCTTGCAGAAGCCTACTACGGAGATGGCGAACCTCTCGGAGTCACGTTTCCGGGAT
ACTATTACCGAGACGTCCAGGTCTGCGCCAACTGCTATGAGTTTTACACACTCGTTGAAAAGGTCCGCATGAAGGCTCTGGATCAAATCGCGCGACGTGG
AGAGAAGAAAACTAGTCCAAACCGCCGAAGTCCAGACAAACAGGATGAAAAACGTACTCGAGAGCTTTCGATAGCCGAGCGAAGAGAGGAGACTGACGAC
GATGGCAATAATGATGTGGAGTATTCAGACACTTTGCAGCATGTGTGGAAGCAAGTGTGGGCGCAAACTTCCGTCGTGGCCGCAGCGATCACGAAAAAAG
ACGCCGCTGAGCTGTACAGCTTTGTAAATCCGCATCCTGCTGTTGCGATGGTGTTGAGTGGTCTGGGGGCTTTGCTTCTGGGGTCACGTGGAGGAGACTG
GGGTGAGGTCAAACGGGTGATCTCACAGGATAAACTCCTCTCGCGGTTGCATCGCGTGGATCTAGAGGGACTGTCTGAACGTGCCGTGATGCAGGCAGCA
GCTCATGCTCGTAATCCACTGTTCACACCGGCACAGATCGCGCCTATTAGTTCATGCGCTGCGAAGTTCTGCGATTGGATCCGTACTGTGCTGCAGGCTT
ACGCGTGGAAGCACAGGCTGCATATGCAAGACACGGGGACACGACGTATGCTTTGCCTCCTCAAATCAGAGATCCTGCCAGCCGGCATTGCTGCTGCTCA
GCTGGAAGACGCGCAACGCGAAAATGGGAAAGTCAAGAAGGTCACAAACGATTCAAACAACGATGATTCGTCACCTACAACGCGGCGCCAGTCTCAGCAG
AAGCAAACTGCTCGACGAGCCATACAAGCTCAGAACATGACACGCCTTGCAGCACCGTCGGGGCTACAAGATGGCGTAGGAGGCGGCACTGCAGATCCTG
TATTTACCTGTCAGGATGGAGTCACGCAGATACCGTACGTAATAATTGGCCAGCCCATCGGTCCAACCGTCAAGTGCAATCTCGTAGTGTTTCACGACTT
GTTCGACACGCTCGAAAGCACTCGAGTGTTCTTCCGACCGATTGTGGCGCGGAACGCGGGCTCACGAGCGCTGCTGTTCAATTTCCCAGGTCAAGCCGGC
TCTGCTTATGCAGTCGATGATCAAGCCCGCGAAGAAGACAAGCTTGTCTTGAACAACATGTGGCTTGCGCGCCGTGTGCACGAGCTACTCAATTTCTTGC
AGCACACCGCTCAGTTCGTCACCTCGGGTGCTCCTTTTCACATCGTCGGGTTCGGAAATGGTGCCAACGTAGCCTCGTGCTACGCCGTACTCCATGGCAA
AAGCTACGACGGATACTTGCAGTCACTTGCTCTTTTCAATGGGTTTGCGAGCGTGGATGCTCAGCTAGCCGCGGTGCTGCACAGCGCAGTGAATGTGTTT
GCATGTTTGCCACCGACGCGACCAGACTTGCCAGTGTCATTCTTCTGTAAGTTTCTCTTTTCAGAGGCGTACTTGTGCAAGGTCGACATGAACTTAGCGC
TGAGTATCTACACAGCTGTGACCAACGCCATCACGCTTGACGGGCGTATTCGCTTATGCCGAGGTGCTCTCCGTCACGCAGACCTGGGCTCATTGCTTGC
CGAGATTGACGTTCCACTTGTCCTAGTGCAGTCAGTGGAAAACACACTGGTGTCCCCCACGAACGTAGATCCATTTCTCCAGGGACGCGCAAGTGTGCAG
CATGTATGGTCCCATCAACAACCGCATACCAGTGACCTGCGCTCTAAAACCCGTGCGCAGATGAGGAAAGCACTAGCAACTCCAAAGAGTGCCTTTGTAT
CATGGCTTCGCGCTGGCCATGAGCTCCGCCAGGAAGCAAAGAGCTACGTCACAGAGGTGATCGAGATGCTAGTCAACTCCCAAACGGAGCGTTCAGAACA
AGATCGCGCGCTACAGAGGAAGCAGACGCGCGCCAAGCAACACCGACGAAGCAGCAAAAGGCAGCAGCAAGAAAGGAGACGACAGTTCCGGATGAGAGCC
AACGTGTCCAGCCGTCACTAACTGATCTCGAGCCTCAAAGTGCTGCAATAACATCCAAAACTCCAGCTGAGCCCTTAGTTGCAGATCCAGCAGGCAATTC
GCTTCTCGTAAGCTGGTCACCACAGCAAACCAACAAATCGCCGTATGACCTTCAACTAGAAAAGTCCGAACGAGCATTTCAGGAGGCACTGCGTACGCAC
GCAGCCCAGAAATCTGCGTACGAGAAGAAGAAGCTCCTGCAACAACCAGGCGCAACGCTGACCACCTCGACAACTGAGATCGCCGAAATCCCAATAACTC
AATCTGTTGTGCCCTTGGACATGCTGCTTCCTCCTGCTCTTCCTGCTATCGTGATGCATGAAAATGATCAAACGTCATGTCCGAACGAAGACAATAGCGA
TACCCAGCTAGATGACGATATCGATGATGTACGTACCAAAATCCGTGCTGAAGAAGTACGACTTGAAAAGGAGGTCGAAGAACAGCGTGAAAAGCATCGC
GCTGCTACTGAGCAACGGATGGCTGCTCTCAGAGAGGAACAGGAGCGGAGGCGACGTGAGTGGGAACAGGAGGATCGCGAGCGACTTGCAGCTCTTGAAG
CACAACTACAGGCTCAACAAGATGAGCGGCTTGCTGAATCTCAGCAGCGGGACCTAGACCAGCTCGCGATGGATGAGGCAGTGCTTGCTGCCGCCAGTAC
AGTCTTAGAAACATCAGTGTCCTCACCATCGCTGATTCTTGAGACGTCTGTCGAAATGCCAATTTCACCAAAACAATCCGCTAGTACGTTGCTGGCTCCT
TCCGTGGAGAAAACACGACAACAGATTCAAGTACAACCAGAACTACCGAGTATGTTTGACCAGCTTGAAGCAGAAGAACACGCTCGGAGACGCCGAGAGC
AGAAACGACGAGCCTTTGGGCCTGGACAGACAGCAGGAAGCCACCTAACCGGCGATCAGTACGACGAGGTACGGACTTCACTAAAGGAGGCCTTCCGAGA
AGATATCCGAGCGAATGAGTCCAACATGAAGCGCGAGTTGCGACGACGGCGTGACGCACAAGCCACACGAGTCCAAAAGTACATCCGCCGGTTCTTGGCT
ACGCGTCGAGTTGATCGTATACGACGTGAAACCCAACAAGAGCGCGTCAAAAACTTTGCTGGTGGTGAAGTCGTGAGGATAGCACGGGGCCGCTTAGGCC
GTAGACGATATCGTAGACTGTTTGAAGAGAAGGAAGAGGCTGCAAGGCGATTACATGCAACCATACGCATCCAGACCGTCTTCCGAGGCTTTTCGAATCG
CAAGGCATACCGTGCAAAACTCCGAGAAAATAAGGCGTGCATGTTAGAGCGAGTTTTTCGTGGTCACCTCGGACGGAAGCGTGCCCGGCGACTGCGCAAA
GAGCAAGAACGCCGCCGCTTTCAGGACCGTAACGCTGCCAAAGTGCAGGCTACCTGGCGGATGTACATCGCGCGTGGCAGATTTCTCACTGCTCGGTTCT
CCGAGCTTGCAGCTCTTGAGATTCAGCGGATGTATCGTGGTCTTCTGGGTCGACGAGAAGCTGCACGCAAGAAGCAGTGGCGCGATGCACCGCCTGGAGC
TGAAAGACTGGCGCTCGGACTTCAACTAATTGAAGGCTCGAAGCAGGCTTTTGAACGACAGCAGAGCGAGCTTGATGCGCTTCATCGCGCACAAGAAGCA
GCCGAGCGTCAGGTTAGTGCTGTGCACAACGAGCTGCGTGAAGCCGAAAAGGAGCTGGCTGTGCTGGAGAACGAACTGCAAGAAATCGACCAGCTAGACG
CCGACGTGAGAGAACTCACACACGAAGCCGAACGACTGCACGCTGGCGGTGTCGAAGGATTGCTACGCAACCACCGATCATCGTTGCAACATCAACCTCT
TGGAAACGGTGTACCGGATACGTCTTCACCACCAGACAGCAACGACCGTGCACCATACCAGCTTGGGGATGAGAACGCGCTGGAGTCGAGGGAGGCCCTG
AAAAAGCGCCAGGCAGACGCGTACGCCGTGGAAATGGCACTCAGCATCAAACGCAGCGAGCGTGAAAAGAAGAAGCGTGACCTGGAAGCGGAGTTTGCTG
GAGCGTTTGCTGAGGTGCAACGAAAGCGAGATGCATTGGCTGCACTGGAAGAGCGGCTTGCTGACATGGAGCAGACTCGCATGCGAAAGGATCGTGAATT
TGCACGTTTGCAGCGGCATCTGATGGAGTTGCTGGAAGAGCAAAAGCTGGAGCTTGAAAACTTGCGCGAAAGGGGTATTGAGCTCGAGACAGCTACAGCC
ACCTCGGCAGCAGCGGCAGCAGCAACGGCAGCTAAAGCTCGCGAGCACGAAGTACGGTCGCAGGCAATGTTTGAATCCACGGAAGAGCTCATGAAGTTCC
AGTTCATGTCGATGTCGTTGTCGTACTTCAGTTCGCTCAATATGCTCAAGAATCTGCGCGACATCAACGCCGACACCACTGCTTCAGCCATCACTTCCAC
AGCGGAGACCGCAGCCACTGCTGCTGCTGCTGCGGCTGCCGCAAACATTACTCCAGTCACCGCAGCTCTCGCGAAGAAGACGCCAGGTGGAGATGCCATC
AGCAATTTACTAACGACTGTGGCGCAGCGCAAGCAGCAAGAGCTGGTGCAGCGACAACGCGAAGAGGAAGAGGCCTTAGCACCAGGAAAGCAGCAGCCGT
TGCCTGAAGAACTACGCGCGTGGACCGTGGGCGATGTTGGTAGGTGGCTCGACAGTTTGTCATTACCGCAGTACAAGGCTGCGTTCAGCGAAGGCGCAGT
GGACGGCGAGTTCCTCGTTGAGCTCCGTGCTGAGGACATGGCTGAAGTTCTCGGCGTCTCGCACAAACTCCATGTGCGCAAACTGCTGACAGCACGCAAC
AAGTTGCTGCCTCTGACGGCGGCGGAGCGGTCTCAACTAGATGCCGTGAACCACGAGGCAAATGCTGCACGTGCACGTGGACAGGAACCGGCAGCAGGAG
ATGAAGCCTCGCTGGAGGTGGACACCGTATTCTCGCAGGCGCGCAACGGGCGGATGAAGCGGCTTGTCGAGAGTCTGGACGCAGGATTCCCTGTCGACAG
CGAGGACGACAAGGGTAACACGCTGCTGCTGCTCGCGTGTCAAAACGTGAACCAGCGCATGGTAGAGCTCCTGGTTACACGCAGAGCCAACTTGAATCAC
CGCAATGCACAGGGCAACACACCACTTCACTTCGCGATGGCCTACGACGGTGAAGGTGTCCTTGGCGAGTACCTGATCGCACACGGCGCCGACGACACCA
TCGAAAACAACAGCGGCCTCACAGCCTACGACGGGCTCACAGCGGAGTAAATGGCGTATCAATCACACAGGACAAGTTGCTAGAGACATTCGTGCCAGCT
CGCATCGTTTGCGAACTCGGGACACTATATTTTTGCTTTCCATTCTGCTGGTGTACCAATGAAGCCTTCCGCAATGCGCACGGCGATTAGATAATACATA
CTACAGCACTCGCTTCCACAACCGACTTTCTCCCTGCTCCAACAATGCCTTGCAGTGCTCCACGATCGCTTGGCGAGCCCCTTGTTACTTTGATGCTGTA
TTCTCGTAATCTTAGGCGTCCACCCGAGCCTCAGTCACACCACGCACCTGGGAGGCCATCATACGGTTAACGGCGTTGACGTAGGCCGTAGCCGACGCTA
CCAGGATGTCAGTGTTGGCGCCGTGGCCAACGAACTGGCGGTCACGTGTCACACCGGTCTGGGCGTTCACGTGCTTCTCATCTTCCGTCTTCTCCTCCTC
CTCCTTGTCCTCCTGCACTCGCACGGTCACCTCACCCAGAGCGTACGTGCCATCCGTCACACTCTCCACGGAGAAGTCATTCAGCTTGATGCTGTCCATG
CCCGTAGCGCGCTTGATAGCCACGTAGATGGCGTCAATGGGACCAGTGCCCATGGCAGCCTCGCTCACCTCCTGTCCATCCTTGTGCGCAAGCGTGACCG
TAGCCGTGGGCTTGACAAGGTTGCCAGCCGTCACATGCACGGACTGCAGCGTCCAGAACACCTCGGGCTTGAACAGCTCGTCCGACACAATCGCCTCCAT
GTCAGCATCCGTGACCGTCTTCTTCTCGTCAGCCAGCACTTTGAACTTCTCCACGTAGTGGTCGAGCTCCTCCGGCGTGAGGTTGTTGTAGCCAAGCTGC
TGGAGACGCTTGCTGTACGCGTGGCGGCCCGAGTGCTTGCCGAGCACCATCTTGTTCTCGCTTAGACCCACCGACTCCGGCAGCATGATCTCATACGTGG
CTTGGTGCTTCAACACTCCATCCTGGTGGATACCAGACTCGTGCGCGAAAGCGTTAGCGCCCACAATGGCCTTGTTGGGCTGAATAGACATACCGGTGTA
GTGGCTCACCATACGGCTGCAGCGGGTGATCTGCGTCGAGTCCACGCTCGTGTACACGGGGAAGTGCTGCGGGCGCGTCTTAAGAGCCATAACAAGCTCC
TCGAGGGCCGTGTTACCGGCACGCTCACCGATACCATTGATCGTAACCTCAACTTGACGCGCGCCGCCCTGAACAGCAGCCAGCGTGTTGGCCGTGGCCA
AACCCAGGTCGTTATGGCAGTGCGTGGAGAAAATGGCCTTGTCGCTGCCCTCCGTGTTGTCAATCAGGTAGCTGAAGAGCGATCCGTACTCTCCAGGGAC
CGTGTAGCCGACCGTATCGGGGATGTTGAGCGTCGTGGCGCCAGCCTTGATGACCTCAGCAAGAACGTCGCACAGGAAGTCGGGGTCACTGCGACCGGCG
TCCTCGGTGGAGAACTCGACGTCGTCGGTCAAGCTCCGCGCGAACTTGACGGCGTCCACGGCGCGACGGATGCACTCGTCGCGCGAGATTTTGAGCTTGT
ACTTGAGGTGGATGTCGGACGTGGCCAGGAACGTGTGGATGCGGTGCTTTGGCGCGTGCTTGACAGCATCGTAGCAGCGCTGGATGTCCTTCTCCATGGC
GCGCGCGAGGCCGCACACGGTCATGGGCTCGCCCGTCGCGCGGTTGGCCGTGAGCGGGCCGACCTCTTTGGCGATGGCCGACACGGCTTCGAAGTCGCCG
GGCGACGAGATGGGGAAGCCCGCCTCGCACACGTCCACGCCCAGCACGCTCAGACTGCGCGCGATGTCAAGCTTTTCCTTGAAGTTAAGCGTGGCGCCGG
GCGACTGCTCGCCGTCGCGCAGCGTCGTGTCGAAGATCACGAGGCGCTCCTTGCCGGCCTCGGCGGCGGCCACATTCGAGAAGGCGCGGCTCGCGTTGGC
TCGGGCCGCGGAGGCCGAGCGCTTGGCGATCGACTGCATCATGTTGGTGTGTACGGGAGGAGGTCAATGGGCGGAGCAAAAGTGCACGTCACTGCTGCGC
TGCGGATTGCGGAATGAGCCGCAAAAGTGCAACCAGCCGCTCCGGTTTGAGCAAACACGCGTACAGAGGTTGAGCGGCTGCATCAGCTCCAGGCAATTAG
ATGCACCACCAGCAACGGCGCGACCGCGATCTTAGCAGGGCCTTTTGACCAATCGTATTGCGCACAACAGACTTTTGGCCAATGGTAGGGATGCGTAAAA
ATGACGTAAAAAGTCATGCGTGGCGTAAAAAAAAAGAGGTAAAAATCTCTTGGCGTGCAGGCCAGTCGCGCTGTCCCGGTGCTCAAGCGCGAGCGGTCAT
ACTGTATCATCAGCACTTCACCACAAGAACGTGCGCGAGGCGCCCCAAAAGTTCAATGCCGCGCGCCTCCAACACGATCATCAATATGTTCAATCTGCTC
GGCAGTTTATTCAACCTGCTCGGCAGTTCAACATGAGCGGCGGTCATGCGCGGTTCGACAGATCCCAGCAGCGACTTCAGGGCATGGACAAAATCACCTT
GGACATTAACTCCTGCTTTGCTGCAGTGCCTGCACCTGGTGGCTGCAACGCTATCACATCTCCATACCTTATCAATGGTCTGCTGCGGCTCATGGCCGAG
CACAAGCAGCGAATGAGCTTGTGGCGTCCAATCCGAGGGCCGGTGCAGCCGTCCTTTCCTTGAGGTCTCATCAGATGTTCACCTTCAACCTGGCCTTGAA
CTCAAACAGCGCGTCAAGGTGGCAGTGCTTGCAGTGGCTCTCAGCCCAGTGAGCTGAGCTCACATGGAAGGACGGCTCGCATCGGAGCACCAGACTGCGG
TGCTGAGGCTCCGATCGAACGTCTTTGATGTAGATGTACCGTCAAGGTGGTACCGGAGACGACTCTTCATTGGCTGATTATCGCATTGACCGTTACGCCG
CAGTGCGCCATGTCCTCGCCAAAAGCATAATCGTCGTGGAGCCCGTGGTCTTGGAGACCAGTTCCGCTCCGGATGGCGTCTCGGCCGCTCGAAATGCCCT
CGGGGCGCATCGCCGCCCGCCCCCCAATGCGGCAGAACGTGGCTCTGCGTTGGGTGAACGCGGTTGTGCCAGCTTCGGCCGCATCCAAGACCTCGCCTTC
GCCCATAAAGAGATGGCCTCCCCCGTCGAATGTTGAAGCCCCGCCTCATGCTCCAGTGATTGCAACATCGATGCCAGCGCCTGCAGTGGAGAAGAAGAAG
CCGGTGTCTGCGGGATTTCAGTCTGCGCGCGCCGTGTTCGAAGCCAAGAGAACTACAACTAACCCGCCGCCAACTCGTCGCCGATTGCCGTTCCCCGCCC
CACCTGCGCCTGCAGTTGTGAAACAGCACTCGGTAGCATCGGATTTGTCCAGCTCTTCATGCAGCACGGTAGACTCCGAGAGCAGCCGCATACTGGAAGA
AACCATGGAAGCGCAGCATGAATTCATGACACGGTCGCCGGTTCGGCCAGGCGAGGCAAAAAAAGTGGAAAAGAAGTCCTTGACGATCACCTCTTCTGTT
ACCGCAGCAGGCCCTGTACCGCGATCACCGCTTCCAATTAAACAAGCCGCTAGCTCTCACATACCTGCATTGCTGATGACAACATCCGCGCAGGCGAAGC
AAGGACAGCCCAGTATTAATGCCACCATTGATCCATTCCAACTTCTTCTTCCAGTTGGAGCGGTACCAACACTTCCCGATGAAGTGTCATGCGTCTATGA
CAACGCTGCGATTGAAATGCAGAAGGGCGTCAAGAAAGTAGTGCGCAAGCTGCTCAAGAAAAACAAGGCACGGCAAGAGGAGTTCAAGGTCAATTCCCGG
CTCTTTGGAACCGATTTCATGGACTCGCAAGCTTATCTGGACACGCTGATCAAGGACTTTGGCGCAATTCGTGCCCTGCAACTTGTTCCGTGCTTGTTGA
GCATCCAGCCCGATATTCTGAAGAGCAAGGCTCTCCTTCTTACCGCCAAAAACTATCTATTGCGAAACGAAGAGTCATTGGAGTGTGAGCTGCGGGCCTT
GACGGCACCAAGTACCAGAGATAGTGCTAAGACTGATGGCGTATCAGTTGTTGGCTCTGTGGCCATCCCGCTCCCAGACGCTGAGGTGAAGACTCTATCG
CCAATTATCAGAACTGCGTTGAAGGTGCCTGCACACGCCTTGGCGGCGGGACCTCAGTCGAGAGAAGAGGTCAACTCCACGGCTACAGTCTGCACCTCTA
TGTCTGACCATGTCGATACTGTCGATACTGCTGCCGGCAAGAACGATTCTGCAGTGTTGCCAATTTCGGCTTCTAAAGATATAGTTTCGGCTACCATTTT
GGCGCTGAAAAAACCGGAGTTCACTAGCCCACCAGGAGGAGTATCACCAGCGACCACTATCCAGTTGGCTGAACCCATGCCAGAACCTCAAGAGGCAGCA
CTAATTGGGCCACCGCCCCATGTGACCAATATTGTGGTGAATGCTCCCACGCCGGCGACGACTACAGCGGTGCGCGGGATTGATGCCAATCCAGTTATCA
AGAAGACTCCGAGTCGGATACTCCAAGCGACAGTGGGGATGAATTTCGTGCCGAAAATCTCTTCGGCGAGCCTATCAATCCTACTTCTCCGCAGCAACAG
CAGGAAGTAGCTGCCATCTCCCCGGTGTCGTCGACGCACAGTTTCGACGAAGCGGAGAGCTTGTTCGGTGAGCGTCTGTCCTGCTCGTCTCGCTCCAGCA
CGAGCCGGCGAAAGACTGTAACATGGGGCGAGGCCAAAACAATGGAGGTCCCCGTACAGCGAGCCTCATGCATCAACAAGAAGCCGCCCCGCTTATTTTC
GGCCTTGCCACCGCAGGCGCCTTCGACTCGGACTCGGACGACTCAGACGTGGCCTGAAAATGAAACATACTCAAGTGTAAAGCATTGTGTCGTTTTGCCT
TGTCGAGGCAACGCAGCTTGCACCGACATGACAGAACGTAGTTTCACATATTCTAGCACACAGGTTGAGGTTCACAATCCCTCGACAAGCAAGATGTCTT
CGCCTCAAATGCAGCCGCGGCAGCGGCCTAGCAGCGCCGCGAGCCTCCACGGCGACTTCCGGGTGGAAGTGCTGGGCAGCCAGGAGTCTCTGGACCTGGA
CTGCGGCAAATTTTACACGGCAAGTAGTGTGTGTTGGCCGCTGTAGCCACGGTCTCCCCAGTCTCACCTTGTACGGCTGCAGGAATACATCCTGCGCTGC
TCGTGGATCGAGCGCAATGGGACGCCAGAGGTTCGTTGAGCAGCAACTTCATTTGCATGGCATTGAAAACAGGAGACTGAATTGGGCGACGCTGGTGCAC
AGATTTGGGACGTCGTGCGACGGTACCGCGAATTTTGCGCAGTCGACATTTTGGTGAGAAACAAGGAGCAGTCCACGCATTCGTCACGTTATACGGCTAA
CAATGTATGCAATACCTATTGTGTGTATTTGCAGCTGCGCGAAAAGTATCCGTCGCGGGCGCCCATGTTCCCGTATCTGCCGAGCAAGAAGTACATCGGG
TCGTCCCTGTCGGCCGACTTTGTGGACAAGCGGCAGCGCGACCTCGGCTACTACATGATGTCCATCCTGCACAGCTGCCCGCTGGTACGCACGTGCTGAA
TTCTATACGCCTGATGCTCTTATTACCCGCCTATTGACACGATTTGGTGTTGGTAGCTCGTTCAAGACGAGATCATTGACTCGTTCCTGGACATTAAGCG
GCACATTTTGGAGCGCGCGCGGGAGGAGTTTAACGACAGCCGCTTGACTTCTACCCCCACGCACACGACGAGCAGCAACGGCGGCATGAGCCCTGCACGG
CTGCAGCTCTAGTTCCATCAATTCAAATACACTTATTACTTTTGACCAGATCAAGTCTCGTCCCCTCGCTCAAACAGCAATTTGCCGAGAGAAGGAAACG
AGTATACAAAGCCCCATACAAACCATAACCCCCTCTTTAATCCGATATGGACCATCACTCTGCGCAAGATTTAGTGGCTGCACGCACAGCAGAGCGAGCT
CCGGACCGGCCTAAACGTGGCGCGGCGCGAGTAAGTTTGGAGCGTGTTCGTTACCAGTCCCCGCGCGAGTGTACGAGCGCTTCCAGTGGACGAGAGCACA
GCCGCGTCAGGGGAAAAGGGGAGAACATGGCGCTCGCAGACATCATGTCGGTGGAGATGAGTGCCAAATACATGGACTCTAGCAGCTCATCGAGTCTGTC
GTCGGACTCGGACGACGTGTTGTCGTCCTCGAGCTCTTCGGCCGTCTCGTCGTCGAACTCGGAGTCGGACTCGGACGCGCCGCGAGCGTCGGCCAAGAAG
AAGAAAGCAGCAGGTCCTCGAGGACGCGCTGGGAAGAAGGTGGACGTGGCGCTCTCGGACTATGAGGACGACTCGGACTTGGACAGTGCCACTAGTGGAG
GCAGCAAGAGGAGGAAGAAGAAGAAACCTGCAGCACCCAGACGGTCGCCGGTCAAGAGCAACGGGAAAGCCAAGAAGACGGAGAAAGCGGCTCCTGTAGT
AGCGGCGCCGCCGAGTCTTCCACCCCCACCTCCGCCTCCGTCGCCTCCTCCGGCTGCACCAGATGAGGAATCTTCCAGTAACAGCTCATTCAGCTCCAGT
TCCAGCTCGGACTCGTCGGAACTGTCGGACTCGGAGACAGCGCTCCCCGTTCCCCCGCCACTCCCACCTGCGGCTGGTGACGCTTCTCCTGCAGTGTCTG
CGGCTGCGAGACCGCCGAAGCGGAGAGCTTCGACCAAAAAGAAGGCGGAAGTGAGTCCGTCGTCGCTGAAGGTGACGCTGAAGCTCCCGCCAGGCTTTAT
TGCAAAAGGCGGGGGAGCACCTGCAGCTAGTAGTCGAGCTCAGGTGAACGCCCAGGCGACAGACGCGATACCTAAACGACCACGAACGCCCACAGCTACA
GCAAAGGCTGCAACAAGTTTGCGGTCTGCCAAGAAGAAACAGCCAGCAGGTCGTGCCCAGAATTCTGTTGTCCAAGCGAATGGGACATCCCCCGCAGTAC
CGCTCGTTCCGGTTAGTCCTCCCGTTTTGCCCAAGCTGATCCCCACTGGTCCGACGGTCCCTTCAGGCGAGGTCCGAGGTGCGAAAGAGCTCTCGCTTGT
GGACCCGGCCCTTGCCAGAGACAGACCCGAAGAAATTATTGAGTCGAATATCCCGGCACACTTCAACGACGCTTACGCTCACGGAGGCGATACGCTGCGC
CTTTTGGACATGTTCTTTTTCTGCGATGAAAACGGGTATGGCGAAGCCTCACTCTTTGTTGGATGGAAGATGAATTCTAATATCGTTGTTTTCCTCGTGC
CGCTTGTTTCTACAGCAAGGCTATTAGTCTCGAGATTTTAGACCGACCAAAAGATCAGCGCCCAAAAATCATGGGGTTTGGAACACTCGTAGAGCATTTG
CCACTAGCGGAGCGTCCGCTTCCAATTCGGCCTATTCTTGCGTCCCCAGCATTTCCCTCGCGCTCCAAGAAACGCCCACGCGCGGATTCCGCCTCGTCGA
CCCCTGCAAAATCCCCATCCGCTAAAGCAAGAGCGAGGCCCAACAGAGGTAAACTGTCGTTGTTGCTGCTGTGTGTCGAACTGGTAATGCGGTTTTGCTT
ATTGTTTGCCATGTCCTAGCAGGAGCCAAACAAAATGACAGCAAACGCCCAAAAATTGAGGATGAAGCCATTTATCAAGGCGATGGCGAATTCGAAGACA
AGAGAGAGAGGTTGCTCATGCAGCAGATTCCTGCATTTTCCAACGGTCGACCGTCTATCGCTTTCCTAGCCCGTTTTACCCGAATCAATTGTCTCAAATG
GATGGACAATCCGATTCGGATAGTGGTGGTAGCGATTTGACTTCAGACGACGAGGATATTCGTTCTGGCCGAAGTGGATCTGGAGCTGGCTCCGAGAACG
ACAGTGAGCTCCTCTCGTCCGCCACCAGCAGTTCGAGTGGTAGCGGTAGCGACAACGAAGTAAACTCGGGCAATTCTTCGTCATCATCCACTGGTAGTGG
TGCTGAGAGCGGAAATGGTACGACGACAGCGAGTCGGCGCTCGTCGGCTACTACCGGCAACCCGGCGGTCATTAAGGCCGACCACTTTCCACAACGAATT
GCTGAACCAGCAAGACCTCCAATTAACAAAGTGCAGAGGCGACCGAGCACCAGCGTGGATTCCAGAAACGCGGGCTTGCCGGCTGATGTAGTCGGACTTA
TGCGAACCGACCAAGCCATTGACGTCAATGCAAAGGGCACTCCAGATGAGCTTAATTTGATGGAGTGCGGTTTCAGACACCCGTCTAGCTACGCTCGCAC
TCGCGTTTGGCTTCCTGAGATCACGGATTGGTGCCTGGACTACGCTGAGGGGGACCCAACACTGTGGGTTGTCACGCCTCATTCCTGGTACAAGATTGCA
GGCCCGCTGTCTGGACTGCTACCTCACTCATCGTACCGTCATACTTTCAAGCATGTTCGTCATCTCTTTGAGGCAAGCTACCTTGTGGCGTACGTTCTAA
AAGAATGGCTGCCGATTAACAAGAAAGTGTCCTATCGAGCCACTCTCCAGCAGATTATTGAGCTGTCTTTAAAGGGCAGATTTCGAGTGGTACGACTGCA
TACTGCATTATGTTGGTGGTGTGAGGATCATGACTTATCGTTGTCTAACGTTGGTGTTGTTGATAACACGTGTGTTTGTAGTCTGCGTGGTTTCTTGTGA
AGAATTACCCGTTCATTCGAGCCCAGATTTCAAATTTGTTTCCAGACAAGGAAGTGTATCTGGAGTCAATGTTCTTTAAACAGCTGCATCGCCTGCACGA
AAACTACACGCTACGTGAGGCAAGACACCAAAAGGAGATGGCCGAACGAGAGGTTCGACGTGAGAAGCGAGAAAACGAACGCCTTCGGAAGAGACAGCGA
GTTGATGATGCGAGGCAGCGCATGATGGACGAGCGTGAAGAAGAACGAAAACTGAAAGAGCACGGTCAAAAATACCCTGTCGAAGATTTGCGCCTGCTCG
AAGGAGATGCAGTCAACACCAACAGCCTCCCTTTGGCGTGCTCGAGTCTAAAGGGAGTTGAGGGCCCTCTTCTCGGTGAGCTCATCATGGCGTGGCAAAC
GATCAGCACTTTCAAGGATTTTGTGGGGCTTGAATCGATTTCGTTGGAGGCACTTGTGGAGTGCATTACGACTAGTTGCGACGAAGGCACCCATGTGGGA
TTAGCGCGGATTTTTATGGCGTTCCTCCATGTCATCTTGTCGGAAAAGTCGTTTATGTCGCTGCTGGATGATCTTGTTGTTGAAGGTAATATCAAGGTCT
CAGACCTGTTCGTGAACAGTGAAAGGACTTACGGAATTTGCGAGCGTGCCTACGGTGACATGTTGAATGCTGTCACTTGGCAAGAGATTCTCCGTCAATT
GATGTCCAAGGACATGGGAATCGACCCATCTATTGGCCACGCAGAGCCTTTAGTTGGGTGTGAAATCGTCCGGCAGACGCTATACATGCAAACCAACTCG
ACACCATTCAATACTCCTGTTGACACATCCGCCAAGGGCCTAGAGGATTACTCGCAGATCATCAAACACCCAATGGACCTGGGGACTATCAAGAAGCGAA
TTGATTCAGGGGGATATGAGGGGTCCGACGGTTACGAAAAGTTCGCGGGGGATATTAGACTGGTGTGGGATAATGCTGTACTGTACAATGGCGAGGAGTC
AGAAGTAGGGCGCACTGCCTTAGCATTGTCGGACGTCTTCGAACAAGATTACGAGCGTTTCGTGATCGGACGTGTTCGTGCAAACCAAAGCAGGATGGAA
GCGTGCAAGAAGGCTAAAGAAACGCTGCAAGACTCATCAGCAGAGAAGGTCAAGACGTTCAAGTATGCCGACGTTGTGTACGGCCTCTATTGCTTCGAGT
TCCACGAACTTCCGACGCCGTACAAAATTGGTGCTCTTTCGTGGATTTGTTCAGAATTCTTGACCCTTTCTAGCATTCGAACCTACATGGCATCTCAAGT
GGATCAGGAGATGCTGATTCACAGGAATCATAGAAAGCGCGCAGCCGATTTGGACTCACAGAGAAAGCACTCCGACAAGATGCGGCGTGAAAGAGAGAAT
GCCTTTAGAAGAGATTGTGCTAACCAAGGCATCCATCCCAATTCGCACAACGTTTTCTCGGAGGGTATTAAGCGCAGGCACGAATTTATCGGCAAATTTT
TCGAAGACATTCAAGCAGAGAAAGCTGAGGACGATAAAAACGTGGAGCAAGAGAAGAAAGTTCAGCAGAAGAAATGGCGAGCGAACTAAGCTCAATTGTT
ATTCGTGAGGCCCCCCTAGGGAGAGACAGATACCACAATTCGTACTATATGTTCAAGCATGATACGAAGCCGCGGTTGTTCATCGAGCGCGGGGATCTGG
AGAGTTCGTGGTTTGTGCCAGCAAAGCTCAGCTTACGACAATTCTGGAGTGGTTAAACCCTAAAGGAGTTCGGGAGCTGGACTTGTTGACGAAACTACAC
GAGGTGAATGATAAGCTACTTAGTGCCTTCGATGAAGAAGAAGGCAAGCAAGACGGAGATACCACCACGGAGTTGGTATGGAATGCTAAGGATGGTATTG
AACTCCAAATGTTCCCTCTTCCGGGTGGCGCTATCAAGAGTGAACAATGACTATTACAGACGCGGACAAGGTCATCAAGTCACACAACGTGACCCGCAAA
ATGTTACTTAGTTTGAAGCAGCATTTAGAGAGCACAAACACGCTGCCTGCTTCTTGGGAAGGTTCTGAGACGTGGAGTGATCGTGTGGAAGAGGCAAAGG
TATTCAAAGAGCAACTCGATCTGTTTGCAAAGCTGGAAAATGCTGCAGTGACAGCCCTGAATTCAGGCGTGGAGACAATCAGACCTTCATGGCAGCGGAA
GCGACATGAGTGGCGGTTGGCACTCGAGGGTTCATGTACATACGCGCAGTTAGTGTTTCTACTGCATCTGCTGTTGGAGGAGTTCATTAATGTGGAGGCT
TTCATGGATCTGCACATCCGACTTGATCGGCGTGAATGGCTTAAGCTTCGACCTAAGGAGACTCGGAACTTTATTCCTGAGTCTGGAAATGTTGTCGTAT
ACTTCGGAGATGGCCATGCTCTGGCGCTAAAAGAAGACGAGAAGAGCAAGAAAAAGCGCTTCACACAGAAAAGTGATACTCCTGTTCGAAATGCAGCAGT
TGTCTGCACGGTGGAGAAGGTATCTTACCACCACGGCGGAGGTGACCCGTATGCGTTGGCGGTATTAAAACCTGTCTCGGACATGGCTCTGCACGAATGC
ATTCGTAAGCCTGGAGAGCTCTTGTGCCCCCTGCCATCGCGAGAACAAAGGCTTGCGAGAGTGTTTCTGCGAGTTTTGGCTAAGCTGAAAATGCTAGCTG
ACGCCGGACCGTTCCTTGAGCCTGTGTCTGATCGGGAGTTTCCACAATACAAGGAAATTATTCCTCAGCCGATGGATCTTGAAAAAATAACCTCCAAGGC
AAGCAAGCTGGAGTACAAGAATGCGGTTGAGTTCATGACTGACCTGAGGCTCATGCGCGATAATTGCCAGCTCTTTTGCGAAGGCCGCTTTCCGACACTG
CCGCCGTTGGCCCACAACTTGGTAAACGTTGCGGATGGACAAATCAAAAAGTGGGGTAAGGAAATTCGTGCGTGCGAAGATAACTTTGATGGCTCGTCAT
CGATGAAGAATAGCAGCACGCTGTCTCCGGAAAAGAAGGACGCTATCAAGCAAGATGAATTAGACGGAGGAAAGACGGAGTTGCCAGCCCGTTCGATCAT
GGCAATTTTGCGCCTCGAAAATCGATTGCCCGAGTACATTGTGGATATTAGTCGTTACGCGTGGGCGGTGAACCGTACATGGCATTGTGGAGAACACTTT
CGTATGCTGTTCCGCAACCCACAAGGGTACCCAGGCGAGTACTACGGAGGGGTAACCGCAGGGTCCTTGCCATTTGATGATCACGGAATGCTGCCATGGG
AGGCGCTGCGTATTACATGGGACGAAGATGACGGGTCGGACGACAATCGCATTAACCCATGGTTCGTAACTTGGCTGGTGTACAGGATGCGATGTTTGTC
TGATTTCTCACATTATTTAAACTTGTCTGACGAACAGGGAAGCGGAGTTTCCTCGGGGTGGAAATCGGGCGTAGATAGAGATAGATGTTCCAAGCTCTCG
ATTTCGCTTAGGCTGATTAAAGTGCTCA