Description :
From Genome Similarity Track
Location :
Scaffold_1342:2554- 3886
Sequence
1332 bases(100 bases per row)
TGTTAAATGTAGCAGAGTGTTCGGGGAGCTTGGAAGCATTGGAGTGGTTGCACCGCAATGGAGTGGTTAGTTCCAGTAGCGAGATGGTGACTCACGCTGC
TCGGCGGGAGGATCCACGTATTTTGCAGTGGATGTTATCGCGCAACCGTGCAATATGGCCCTGATCGAAGCATGTGGGGCCGGTCGCATTCAAAATATTG
AGGCGTTAGCACCTCGGCTTCGGCGTTTACATGCACATTGTGCCAACCGATCGGCGGCGTCAGGGCATCTTAACGTTTTACTGTGGTTGCATGATCACGG
TGGTGTGTTTACCCAGGAAGCGATGGATGTAGCGGCTGATGCCGGCCATTTCCATATTATAAAATGACTACACAGAAACCGTAACGAGGGCAGTAGCCAG
CATGCAATGGATAATGCCGCCCGGCAAGGTCATGAAAATATCGTCCGTTGGCTCTTCGAAAATCGGGCTGAGGGATGTACTAATTCGGCATTGTATTTCG
CGGTGGTTGGGAATAACCTGGAGGTTGTTCAGTGGCTGCATCAAAACGTAGTTAAGGCGTGGCAGGGTTCACTGATGGACGCCTGTGCACTGTATGGGTC
ATTAGCAATGATCGAGTGGCTCCATGACACGTATCCAGATACATGCACTCGAGAAGCGCTAGATAATGCCTCGAGAGCTGGAAACGTGGATATGATGCAA
TGGTTGCATTTGAACAGGACGGAAGGTTGTACTAATGCTGCAATGAACCATGCCGCTTTGAGAGGTGACGTGGGTACTGTAGAGTGGCTACATCGTAACC
GTGACGAGGGCTGCACAGCGCAGGCCATGGATGATGCCGCAGCTCATGGATATACCGAAGTTGTCCGTTGGTTACATGATAATCGCAGAGAAGGTTGTAC
GGTGGCTGCTAtagatggagcagctacgAATGGGTATCGCGAAACTGTACAATACCTCCATTTCACTGTTCGTGCGCCGCGTACTACTCGTGCCATGGAt
atggcagcagcacatggCCATGTCGAGGTGGTTCGCTGGTTACACAGAAATTGGAGGGAGGGTTGCACGGAATACGCTATgaatgctgcagctggaaaaG
GTCATTTCGATGTCGTCACCTTCCTTCACAACAACCTCAGCGAAGGTTGCACTGAATTGGCTTCTGGATTGGAGGCGATGAATGGAGAACTTGAAATGGT
TCAATGGCTTAGGACATTTTATCCGTTTGAGGTCGACTTGGTCGGAGTACGGCAGGCAGCCCGAAATTATGCGTGGCCAGAGGCAGTGGTGCAAACATTG
AGATAGGAGTAGGAAGCAAGTGCAAGCATTGT