Description :
From Genome Similarity Track
Location :
contig_187:25536- 27120
Sequence
1584 bases(100 bases per row)
GTACACTCCGCGACAAGATAAATCACCCACCCTCGTTTGAGGCACAGCTCTGTCAATATTACGAGTTAGCTATTGCTGTTTAGATATGCTGCTTCTGTCA
CCAATAGACAACGTGTTTGTGCTAACGATTGCAATTTCGCAGCGTGCGGGGGACCTCCAATACAAAATTCCATTTAAGCATAGCGACACATTAGATCACC
CACTCGAAGGTACAAAAATCAAGTATAAAATAATGACGGTAATTTCAATAGTGCGTCTTATGCCTTTCTTATCTAAGACTTCGATGCATCTGCGTGGCAT
GGACTCAATGAGTGACATCAGCAGTGCATGAGGAATGGATTCCCAAGCCTCAAACAATGCAGCCCAATTGAGGCACCCTATCAAATTGTCTTCCATTTGC
ATACACTCGCCTACTCATAATGGACCACAAATTCTCAATAGGATTGAGATCTGGGGATCTTGATGGCCAGTCGAGCAAGCGAATATCTTGCTCAGAGAAA
AACTCCTTGGTGCGCTTTGATGCGTGGATGCTTGCATTGTCTTGCTGGAAGATAATCGATACCGTAGTTTAGATGAGCAAGGGGAGGAGATACTCGGAGA
CAGTGACGTAGTCATCCGAGTTCTGCCTCCCCGTAAGAATCACTAGAGGCGCCTTACCACGCGAGCTGAAGCCAGCCCAAACCATGACAGATCCGCCACC
AGCCTGGCGCCTCTTGGTCTGGCGGGGTGGCTTGCGCAGGTCTCGCCAGTAGTGCTGGAAGCCATCGGGTCATCCAGGTTCCACTTCTTCTCATCAGAGA
AGATAATGGAGTCCCAGATGACCCTAGTGTCCTTGCACAGCAGCATGGCGCTGGCCCACGCTTTGCGTTTCAGCATGTCTCGGGCTTGAGGGGAGCGTGT
TCACCATCTTGGTGTACACCAACCAGCCACCCTTGCTAGGGTGCGCTGGATGGTGCGCACTGAAACGGTGAGCTGGAGCTCCGTCTTGAGCTGGGCAGCC
GACAACATGCTCTTAGCAGCGCGGATGAGACGGCGGGTCCTCGCGGTCAGAGAATGCCGGGGCAGGCCCAGGTCGCTTGGCTTCTTGGTGTGGCGGTGTA
GGCGTCGTGACGCGTCTGATGGTGTGTGTGCATCGCCCTGTGCTCTTCGCAACAGTACGGGTGCTCAGCCAGCTTCTCGTAGCCCTTGGATCCTGCCCTT
TTCGCGCTCGGTCACCCGAGGCTTCTTCTTGCTTGCCTTCTTCATCTTTGGAAAATGATCCGCTCCACTGCACCCAGAGTAGCGATCTCGCAGCGCCAGT
CGCTCAAAATGCCAGTTGCACGCCACTCATTTCCCAAAAATTACCGTCATTATTTTATACTTGATTTTTGTACGCTTCGAGGGGTGATCTAATGTGTCGC
TATGCTTAAATGGAATTTTGTATTGGAGGTCCCCCGCACGCTGCGAAATTGCAATCGTTAGCACAAACCACGTTGGTCTATTGGTGACAGAAGCAGCATA
TCTAAACAGCAATAGCTAACTCGTAATATTGACAGAGCTGTGCCCTCAAACGAGGGTGGGTGATTTATCTTGTCGCGGAGTGTA