Description :
From Genome Similarity Track
Location :
Scaffold_93:2553- 11417
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_93-fgenesh-gene-0.1Loricrin
Pytir_DAOMBR486maker-pir_contig_93-fgenesh-gene-0.3ATP-binding Cassette (ABC) Superfamily
Pytir_DAOMBR486maker-pir_contig_93-snap-gene-0.8Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_93-snap-gene-0.10Protocadherin Fat

Sequence
8864 bases(100 bases per row)
CAGCTGCAGCAGCGATCCAAAGTCAAAGCCAGCCAGCTGAGCCGAAGCCAGCGAAATCGTCCCGCAGAGCCAAACAGTGTGTGGCTGAGGGCTGCGATCG
TCGAGCCCAGTCCAACAATCGATGCAAAACCCACGGAGGCGGCGCTCGCTGCCAGATGCAGGGCTGCGACAAGAGCTCCCAGGGCGGTGGGCTGTGTCGA
GCCCACGGCGGGGGCAAGAAGTGCCGCATCCCAGGGTGCACCAAGGGCACCCAACGGCTTGGACTCTGCTACTTGCACGGCGGCATTCGGCGCTGCATCA
CCGAAGGCTGCAAGAAGAAGGATCGCGGCAACGGCTATTGCATCTCGCACGGAGGCGGGCGGCGCTGCGAGGTGTTGGGCTGCGATCGCTCCGTGCGGAA
AGGCAACCGCTGCCAGACCCACCAAGTCGGCGGGGCTGAGAGTCCTTTCCAGATCACAAGAGGCCAGGGGCTGGCGTTTCCGTAGAGCTGGTGGTCAACT
AGTGGCGATAGCCACGTGTATTTTATAAGGTCTCTAGATCTAGCTGTAGCATGCATTTCTGAAGTTGATAGACATCAATGCGTGAATGATGAAAATGATA
ACAAAAGAACCGAATACAAATGGTACTATTATACCGAAATTTAAAATCTGGATGCTGCACCGGTGGGCTGAATGAAGATGCACTCTCTAAATCGCGATAC
TTTCACAAAGTTTACGCGAAGAAGGCGGCGAGAGCAGTGGCCGCAGCAGCAGAAGCCACAGCGAACGAGGTCGTGGTCGCAGCGCTCGACGGGGTAGGCG
TTGGAGCGGTGGTGCGAGGAGCAGTCGTGGAGGCGCTTGGAGCAGTCGTAGTGGTGGTCGTCGTGGAGGTGCTAGGGGCTGTGGTTGTGTCGGTGGAAGC
TGACGTCGAGTTGGAGGTAGCCGCATCGGATGACGCGCCGCAGGTGACGCTGGCCCAGAGCGAGGGATCCGATTTGCTCGTCGCGTCGCCTGGGTGGGAC
ACGCCCGTGGTCCACTGCACTTTCACGTTGGACTTTTCGACCCATTGGCAGCACGGGTCGCCAAGCTCCTGGCCGTTGGTCTGGCCATCGCCGTCCGAGT
CCGCTTCGCAGAGCTCCTTAGTCCAAGAGTGACCCGCCTTGCCGAAGGCTGTGCCGAATGCGTTGCGAGCACCGCCGCCCGACGGGTTCACATGGCCCAA
GGCGTCCACTCCCTTCACGTCGGAACCGTTCGGGATCTTGGCAGGGTACGTTGGCAAGGCGGTCACTTGCGCGACCGCAAGCACGGCGGTGACAGTGAGC
ACAGTAGAGATTTTGCTTGGCATCTTGAGAGATCGAAGGTGTTCTTGCTTGGGGGTGGATGTGAGCACCGGAGTACAAATGGAGAAGTGAGCTCTTGGGT
AAGTGGGTGGCTCAGGACTCTACGGAAGGCAAAGACGCGCTCGCCGGAGCTTCAGTTGTTAATTGAGTGTGTGGATGGGCGGTCAGGGCAGTGAGGTATG
GTGTAATCATGTTTGCTGACGAAAAGGCGTTCCGTGGATTTGAGATGTTTACCTGGAGATGGGCAGCAGGTTGCGCATGCTTTCACTTTACGTGAGCGCC
TGTTTCTGCCCAGAAAATCCACACAGGACCACCAGAACCAAGCATCAGATAGCAAACCATACGGAAGGCAACGATGTGGTTGCCGGAGAAAGAACGGCGT
TTGAACTGTGGTTGCCGGAGGAGGAAGTTTGCTTGTTTGTGTGATGCTCTGCTGCAGGCTCCTTCATCCGCTTGCTTGCAGTGTGATCTGTGGGTCGGGG
TCATCCAGGGTACTGTCTGTAGAGTCTCAAATGCGGCCATCTGCTCACAATGTAATCAGATTCAGCCTTGTACTGTACTGTGTGGACGAAAGCTCACTGT
GAGGAGCATTTTGATCCGGAGCAGAAGGATCGTGTGCTCGTAATTCTCCACACGGTTCATTTCTTGCGGTGCCTGTGCAAGTCATTGTTCATCTTCGAAG
CCGTCGCCTTACTCGCACCGTAAGGTGTTTTCCCTCGCTGCTGAAGCGGAAAGCAATATTTTGACCCAAAGCGCAAGTACGGTGCTGTGGGTCTGTGATT
CTCCATCCTCTTATTTCTTGCGGTGCCTCATTGTCCAGCGCGGTTGTTGCTACTCTCCCTGCAACCATCGCAAGGTATAGCAGAAGCGGATAGTTGAGAC
AGCTTCTACTTCACCATCAATCGTGATAGTTTGTAAAGTTATTCGCTCTAAGGATTCAGGTAGGACGCGGCTCAAATGGGCTTGCTACTGTACTGCGGGC
TGCGAGTCCGCGTGGTGACGAGATCGGATACAGTACAAATACGGTTTGCTTTGTTGATTGATGTGTCTCGCCCCTCCCCTCCATCGTAAACATCGCGACA
ATGTCATCGACTTCCTTACGTCTATGGGCTGTGCAACTGATGGAATCCGCAGCGATTTGCATGTTGTAATCGCTTTTGCTTACAGCACCACAGAGGAATT
TGAAGCACTGTGTGTGGAGCCAGCTAGCTCACATGTTGTCTACACAAGCAACGCTGGAGCGTCCACAACGCAGTGAATGTCGACCGCTCGAGCTGAGCTT
CTTGTTGGTCACGAGTCGGGGTCTACGAGGGTCCTGAAATGTCTATTATCCGTCCATTCAGGTGCGTTTGTCTGGCAGAATGCACTCAGCTCACGATGGG
CTGCTGCTGCTACAGTTGAGTCTGCAAATTTGATGAGACTGAGTCGCGACGAATCTGCTCTTTTCTGACTGGGAAATATTATAGGAGGACCATTCGACGA
AGGTAGTCCCAAAGGAGGGGAACATGTGTTAAACGAGGATCAAAATCAAAAATGCTGCCAAAGGCGTTTCGAGTCATAACAAACCAAACTGTTGTCAGCA
ATTTCCCTGGTTTTGGAGAGGTAGTGAAACGTCGCTGTGGCACTGTAAGCTCTCAGCGTCGTTGTCGTCTGCTGTAGTTGTGAATTTATTGTTTGAAGAA
GAAATCCAAGACAGGCATTCTCCTTTCAATTCCAGAAGTCCAAACACTGAGTATTTTATACACGTGATATTTCACTTATTTTTGTTGCGCCTCTCAGTGT
GATTTACACGTACTATTTCGACTAATCATTTTTGATTTTGGTCCTCGTTTGACACAAGTGCTCCTCTTTTTGCATTATCTTCGTCGAGTGGTCTTCTTTT
GCCATTTACACCTTTTCTGACTCTATTCGTCCAGCAAACGATGGGTGACACCATTTTAACCTGTTTAAAACAACATAAACAACATGTGTTAACAGGATGT
CTGGATAGGGACAACGATTGGAGCCAAATTTGACAACCAGATCCCTGCCACTACACTGTCGAGCACATGTGAGGGATATTTGGTTGTCACCGCAGCACTG
TGTCTCTATTTAGTTGCCGCTAATAATAAGAAGCTCTTCAAAATGAGAGCTCTCTCATCGTAGTTGCTATAGTGAAGCCATGCGCTTGTGCTTTCATCGT
GCGCGATGAGCCTCCTCGAGAGTGACGTGCTGGTGCATCGGGTTCTGGGTGCGACGCCTGACTGTTGCGATCCGCCAAACGCTGCACCGGTGGACGACGA
GTACGACGAGATGGAGGAGTGGTTCAGCTCCTCCTTTCCGGCCCCAGCGTCAGCGGTCGCAGTCGATCCGCGCGCCGGTAGCGCTGCGCGGGACGCTCTG
AAACGCGGTTCTGATACTTCATTTGGCGGGTCAGACAAGCAAGATCCTGGTTCTCAAGACACTTCGCCAGCCGAGGCAGATAGGGCGGAGGAGAGCGACG
CGGATGAGTACGAAATCGACTTTGGTCCGAGTGTGAGCTGCGGAACGTATAATGAGCAACCACTGGCGGGGTCACCTATGGGTGGCACCACCGAGCACTC
GACCTCCACAGAGGCGCATTCCGCGTGGTCTGGTATCGTCGCACTGCCCACTGAACTGGAGCAAGTAGGTGAGCCCAACATGGTCACTGTTGCTGTCGCT
CAAACCAAAATATTTACACGAAGACAGCGCACCAATGACTTGGACGACCCTTCCTCTTCAGCTTCGAGTGGTTGCGGTCGGTGCAGGAGCAATTTGAACG
GGAAACTCATCGTCCGCTGCGCCTCGTGCTCGTTCCGACAGCATCTCTACTGCTTCGTGCCACCGCTCAAACAGCATCCCGCCTTCCAGGAGCAGCTGCC
GCTCGTCGCCGCTCAAGGAAAGAGAGTGCATGTTCGACCGTCTGCGAACGTGATCGCGAGGTGGAATTGCGGCGAGTGCCGACAGAAGCTCTTTGCGAAT
CAAGCGCCCGAGGATTCGAAACCTCAGCGTTTTCACCCTCGGATCAGTTCCGACAGAGTAGGGAGTTTGAAACCTGCAAAAGCGAGCCAGAAAGTCCCAA
GAACCGAAGGCAATCTTCAGTATTCTCCGACACCAGTTGAAAGAACTACATTGAAGTCCCAGCTCAAGAGCGAAAGGAACGACAGCGAGGAGAACGTGCT
CGACCCTGTGCAAGACAAATGGAGGCGCAGCGGCAAGAGTGACTTCGACTGGTACGCGTTCCGCACGGACAAAGCGCAGAGAATTGCTTCTCAGAGTGAA
AACCTCAAACCAGACGAGCTTGTCTACTACTCCAAGCCCTACGCAGATTTCAAGAAGACAGCGCTGAGCTGGATGGAGCGCGCCGAGCAGCAGAAGACCT
TCAAGCGGCAGCGAGAGCTCACCGAAACGAAAATGTTGCTGCCTCAAAAACGGAACGTCATGCACAGATTGACGGAAAAGGAGCTGGTGCTCATTAAAAC
CTATCTTTTGCGTCGAAAGGAAGACGCAGCAGAAGAAATGGAGTTGTTTGACGATACTCTAGCCTACCAGTTTGACATTTCGCTGAGCAGGATTCGTTTC
CTGCGGCAGCCCAGACCGGTTGTTGAAGCGCCTCCAGCTTCTGCCAATGAGAAGGATGAGGAGGGGCAGGACACAACATGTATCGCTCTGCTGCTTTTAC
TGAAAGAAATGACGGAAACCATCGGTTTAACAGCTGAAGATGCAGATGCGAATTCGCTACACGGCCTCCCGAAGGCGTTCACGTATGGAAAAAGCGCTGC
GAAGGTGAAGTGGGCGGTAGCCGGGACCCAAAGTACGTTTGTGCGCTGGAGCTACGAGGCGAAACTGAGAGAGAAATCCAGAAAGCAGCAAGATCTAGCA
GAAGAGGAGCGTATCCAGCGCCAGATGAAGACCACCAACGATATCCGATTCCTGCGATCGTGTGTACGCAGCGTCGCCCTGCTCATGCGGAAACTGCAAA
GTGCGCAGGTCAAAAAGCAGCTGCTGCTAGCTCTCCAAGAAGCCTCAGAGGACTCGCAAGTCGCAAATTCAGTTGCGAATGATGCCGAGAAGGTAAAGAA
GCTCGCGAAGAAGCGCATCCAGCGCTTCTTCCTCCACCGCGTGCGTCGGTACGTTACTCTCAAGAAGCAAGTGATGAGTCGACGCATTCTCCACTGGTGG
AGGCGAAAGTACTTGCATTGGCGATGGTGCGAGACAGCGACGATCGTGAGGGAAAGGAACCGCGAGAGAGCAGGTCGTGTCGTTCAGAGAGCGTACCGGC
GATTTCGCACCAAGAGAATTTTCCGAGAGATCCTGGAGAAACACGCGCTGCGCAAGGTCAAGATGTTCTTGAGATCCTGGCTCATGGCGCGCGTGATAAA
GAAAGAGAAAACTCGAGTGGAGATCCGCATGCTCGCGGTTTCGATGAGAATTGCAGACTGTGATGCACCCAATTGTCGTCCTGACGCCACCATATTTGAG
ATCCTGTATGCGCTTGGAATGGGGTTGTATCGAACCGGAGACTTCTGGAATGCCGCGTGTGTGCTTGAGCGAGTGTGGAGACTTGACTCGGTCGGACTGG
ACTGGGAAGGCCGCCTGGCGCTCGCGTACTCCCACCATATGGCCTGGTACTCGTCCTACGATGCGTATAACCTCACGCAGTCCTGCGAGACGTACTGCAG
CGCATTGAACGACTTTTTCCAGCGCACTTCGCAAAACGCGCTTGGTGAGATTGACTCATTCGTCTTGCAGGACACAGCGGTCGTGATGATGCATATGGAG
AACTTTGGCGGCTCACTGCGGCTACTGGCGCGTTTGATTCAGTTCTTCGCGCAGCACGAAGCGTTCTCGCTCTGGCTTCTCCTGGCAGCTGTACAGCTCC
AGCAGAGAGGCGAGTGGGTTCAGAGTGTCGAGTACCTGACGTATATTCAGGACATGCCGCCGAGTCCGTATCTGGAGCGCGACATCCTCTGTCTCTGTGC
CATTGGCTNNNNNNNNNNNNNNNNNNNNNGCAGAAGAAGGAGCCGGGGAGTCGGTCCGCAAGTAGAGAGGCGTGGAGCGCAGCGCTGCGGCAGTGGAACC
TCACGCAAAAGGAGCTCCGTGCGTTCGAGGAGAGAGATTTGCGGAGTCAGTCTCGCAAACTAACGGCTCACAGCACATTTCGGAAATGGGAAATGCTCAA
TGACTTTGCTCAGCGTGCAGTAGCGCAGGGGCACTACCTGCTCGCTTGCAGATTGATGCTTTTCATGCTGGAGCTGCATCCCAGCGGTGGACAGGGGAAC
TCGGACGACCCAGTGGAACAAACTCAGCACGCCAGTGTATGGTGGAGCCTCGCAGACATGTTTCGCCATCTCGGCCACTTGGATCTGTACGTCAATGCGA
CGAAGCGGAGCCATCTTTGTGTCGAGCCCAGTGACGCCTTTGATGCTGGTTGCGATCGCGAGCGAGTGGCTGATTGGACAAGGCAGGCGGAACTACAGGC
CCACAGTTTCCAGCGCGAAGTAGATAATCTCTCTGTGCTTGAGCTCGTGCGGAAAATCCACGTCCAGTACTCTCAGATGTAGAAAAGAATATGACAACAT
AAAGCGTGGACCACGTTATGCATATCTAGGTATCGCCTATGGTAGAAATTCCGCCACGTATTCATCCAGGTCGACTGCATTTCCACTTGTAGGTGTAGCT
TCAGCCTCCATTGGTTCTTGAAGGTACATCGACTTGCGAGAGTTCACTGCCAGAGGTTTTGTGCCGTCCGTGAACCTCGCCTCCACACAGACCCGCGCCA
CTTCACTCTGTTGTGACTTAGAAAATGAAAAGTGTGTCAGACAAAATGGATAGGCCTACCGTGCTGTGTCTCGCAGTATAACGGCATTGTACGTGTACAG
GACCGCAAAAAAAGTCAATGTCTGGCTGGTGAAGAAATCCTCGGGCTTCTGCTTCTACCACAAGCTTTGTGTTGTGAACGACGTCCTAACGATGGACGGC
TCGGTGAACTGATCGAAAGCTGTAGTCAACCACAACTCCGACCACGTTACCTTCCGAGCAAAAGACGAAATCGCAGGTATGTAAAAATGTCGCTTTGTTG
CAGCCGCATCCAATCACTAACCGCCAATATGCACATATCCACAAGTACATGAATCTCCACGTTCAACAAGGAGATGTTCGAAGCATATCGCCTGCCTCTG
CATGTTTTTGACACCCTAAAGGTTACAGCCTACAACCTCTCCCTTCGAGGATCGCCGACGCTAGTCGCATCAATATCGTCCGAGCGCTGGATTTGCGCTG
TGATCTCCTCGAGCGTCAGCTCGCTCGCGTTCGACCCTTCCTCCGAGTCCAAGGCCGACTCTGAATCCAAGAAACGGTCTTGCTGTCGCTGCTGCTCGAG
AGCCTTCATCGGAGGTCCTGGGGCTACGCTTCGGCGTCGGCGAGATCTCTCCTGGTCGGTGACTTCAGCGCCATCTGCGGAGAGGAAGTCGGAGCGGCTT
GCTGAGTCGTTAGGTACCTGCGGGAGCGCAAAGCTACCGCGTCGGTGCTGCTTGCGCTCAAATCCGCGCAGCTTCATCTCCTGCAATGCCAGAATGGCGT
CCTGCTGGCGCGTTTTCTGCAGTAGCACGCGCGCGTTCGCCTCCGCTTGCTTCTGGTGCAGCGGGTTCGCAGTCATGTGCGCCACCATCTCCAGTCCGTC
ATCGTCATCTACGTCCTCAAAGTCGCTGACAGCGTCGTCTGCGCGCCGTCGTCTCTGCCCCTTCGCAACCTTGGACTTAAGCGGCGAGTGCTGGCTGAAC
ACCTTCTGCACCTTGTTGATCTTCGTAAAGTAGTCAGGATGCAGCGCGACCATGAGTTCGGTCACGAGCACCACAAGAAAGTACACACCGCTCGCAAAGA
TGAGCAGCATCGTCCACGTCGACAGCAGCTCGGCTGACACGTTGTTGAAGCCGTCAATGGAGTTCCCCAGCTGGCCGCTCTCAAACATGATACCGTTCAG
CAGCACGAGACAGGCGCTGAACAGGAGCGTAGATTCGACCGTGTTGTGGTCCCAGAGATACTCGACCACGTTCATGTTTGGGCGCTGCTGGTGCGACTGA
AGCAGAGCGTGGCGCGGAGAGATCATCGACACTTCGTTTCTACGAGCACTCGCATTACCAAGTGCTCGTGAGTTGCCGGCGGACTTGTCTCCACGAGCCC
CTGCGGGGGTCCACGCAGCAAGCGGGGCGTTCGAATGTCCCTCGTCGACGATCCGCAAGTGCGCTGGCTGGATGAACTTCTCGCCGCGAGCTTTTGCGAG
CCGCGTCTCATGGGCGACGTGCTTGGCGTAGTCGTCCACGACGTGCTGCATCTCGTAGGCGCTCATATACGGCCGGTTGCGCACTTGGAACGCGTAGTTC
ACAAAGAGTACCATCATCACGGACGCGAGCTGGAACGTTGGGTATTGGCGGAAGAGCAGTCCGACCACTGCGAGCAGGAACTTGCGCAGGATGATCACTA
CCATCCAGTACCAGAACTTGGGCTTGAACTGGTAGTAGATCTTCGAGAACTTCTTACGGAACTC