Description :
From Genome Similarity Track
Location :
scaffold_221:25528- 27878
Sequence
2350 bases(100 bases per row)
TGAAAGACCAAGAACCAGAAGAATATACCAGCATGGGTGGGGGTAATGTTGGGACCGCGTTTGAAGCGATGTTAAAGCGAGTCGGCACGAAGTTGACACC
TGAGGATCTCACAAGGCTCTACCCGACTCCGCCGAGCGGGAAATAAACCAATACACCGCTCGTATTGGAAGATTGTAAGTTCTTCGATCTCTTTGATGCG
GATCCTGTGGATGTTGGCAAGGAAATTGAGCGACTACGCGAACAAGCGAGGCAGCAACTTGGGGCTTTGAACTTGAGTTCAATTTTGTCGTCAAGGAGGC
ATCACCCACTGAAGAGGATGCCAACCGATTACCGTCTCACGCCAGACGATCATCCGATTTTTCACCACCAGCGATACGGAAGTCGATCGTCCCGAGCCAG
ACCAGGCAGCGAAAGTACCTCATCAGCAACTCAGAAACTGTGTAATGTCCACGAGGCTTAAACTGTGAGAAATCGACGTCACGCTTGGCTGACAATATCT
CCGTCTTGACTGGTTCTTCTTGATGGATCAAAGTCAGCAAACATTCCAATTTGTTTGTGTTTTCAGAGAGACCGCGCTCTGGTATTCCTCGCAAGAGACT
TAGTGCTACTCGGAGGAACAGCTCAACATCCACCATCGCTCTTCTCTTGTCATCATCATCCTTTGGGGCAGCAGAAATGGCCTTCGTGCACAGATTAAGG
GTTGCCATCAGCACTTTGCACAGTGTGGGCGACAGTATTAGTAACTCCACCTCCACTAGAAAAGTGTCAAAGCTGCGGTGCCACGCATGCAGAACTGAGT
CGGCCGTCACAAAGACCGGCATGTCATCTGTGTAGAGCTGATAGTAGATTTCTGCAAAGCTCTTCGCCGGCATACGCTCCACCGCAACGAAGCCATTCGA
TGCTAGTTTCGTCTTCAGATCTGCATCAACTACGCTGCGCTGTTATGTTGGTGAATTTTCTACAGGAATCGAAAATGCTGGGGTTTGTGGAGATACTTGA
CGCAGTGATTTCCAGCCTGGTGGGTGATGGAGGGATAGGAGCTGACTCACTCTCACCTACTCGACTTGCTCAATTACTATCGGTGGAAGCAGAAGCCAGC
GATCAAAAAGCTTTGGAGAATATTCAAAGCTTGATACTTCAGAAAGGAGTTGGAACTCAACTAATCAACGGACACACTCAGGAACCTCAATCGTTTGCAG
TACTTGGACAGCGGTTCGTCTGGAGTTCCTTTATCTTCTCGCGGTTAGTATCTGACCACGTTCCCTTGGGAGATGGAAGCCAAAAGCGACGCATTCCGAG
TGCGGTTGATGTCGCATTCACCCTGTTCGGAAACGACAGTGCGGCTGAAATATTAGCTGATCGAATGAATGATGAGCCACTAAAAGGTGGTGGTTCACCG
GAGTTTGTTCCGTTTCGAGATGGTATCCCGTTCTCGTCGAATCTAGTGGCACTGCGTCAACTGATGGACAAGGAATTTGACGATGACCTTTCCAAGGATG
CTGATGATAAAGCAAGCATCAGCATGTTATGGCAACGAGCTTTACGTGCGCTGTCACGACCGTCTCCGAACGCGTCACCCACATTTCAGTCGAATGTTTG
GCGTTTGCGCCAAATGAATACGCAGTTGGGGTCGTTCACGCAGCTACGACATGACACCTTGCTTTACACGAAGAAAGGCAGCACGATGCAGCTCTGTTGT
GAATATGCAGACGGTATGGTGGATCCGTATCCCGTCTTCTGGCAGAGAATGGGGGAATTGGCCCAAATGAGTACCATGCTTGATAAGCTATTGGCACCCT
TGATCTTCTTTGGTGTCTGGAGTCCAAGGTTTTCATGTAATGCAAGACCCTTTCATTCGCCCGACAGTGAATACTTCCTGGGTAGAAGTCGGCGATTCTT
CAAATCTTTTGCGAAAACGATGAAGTCCATTGAAGAGATTGCAAGTCTTCAGGCTCAACATCAACCATTATGTGAGACCCAAGTGAACTTCTTAAAGACA
GTGATGAAAGAGCGATTCGGAAGTGGCGGATCAAAATACGAGGGGTGGTATCCGCGGCTATTTTTTGAGAGCCGTGAAGACTCAGGCAAGAGCGACGTTA
TCGTGGTTGACGTCCATACAGATTTGCCATCGCCAGTGGACGTGGATCCAGGAAGTGTGCTTCACTTGGGGGTTGGAAACCCACTGATGGCATTCTTTGT
CGTGGACAATACCATGTTCGCAGGCCCAGTGTTCAGTAGCTACGAGTTCTTGACACCAAGTGATCAGCGTCTGACAGATGAGGAGTTCGAACGCAAACTA
CCAGCTATGGAGATGCCTGAGTGGCAGCATCAGTCGCATTTGTGCTTGGT