Description :
From Genome Similarity Track
Location :
contig_60:255259- 274588
Transcript NameFunction/comments
g9100.t1hypothetical protein
g9101.t1hypothetical protein PHYSODRAFT_552331
g9102.t1hypothetical protein
g9103.t1hypothetical protein
g9104.t1hypothetical protein

Sequence
19329 bases(100 bases per row)
CTAAAAATATATGATATTGCAACCGCCAACACTTCCAAGCGGCAGCACTCAGGCGTTCCACTCGATGAAGCAGCAACAGCATGGTCAGATTCAGATCCTG
CGCGACAGCGCACCAGTGGTGGATCTGGAGAGAGAGCCTCGCACGAATCGGTCGTGGGCCTGGGTCTGCTCTGCACTTGTTAGCAGAGACAAAGGCGAAT
GCAGCGTGCACGTGGTCGAGACGGTGATCGTGGACAAGCAGCAGATCTGGGCTTGGTACTACACGGACGCGGGTGTCGTACGCCGCAAGCCGCAGAGTAA
ACTCTCGCCGGAGCAAGTGCATCGCGCGTTCTTGCAGTTCGCCGATGAAGTCGCTGGTCAAGTTGCCACGTTGGACGATGCGACCCGACCGGTTGCAGCC
TGTTGGTTTGAGAAGAGCGATACACCCGGTGTCGTACCGTTCCTCGCTGCGCCAGACCTCTTGGTATTTTTGAATTCGCTCGGATCCGGTAGTTCATGCA
CTGCTGCCATCAGCACTTTCGTCCGTCCGCGCGGTGAACTAGACCCGGGCTGCTATGCCAACCTTGAGCATGAATTCACGTAAGTAAGTCTTATTGTTTG
CGTGTTGCTGGTAGTTCTGATGCATTGTGCTTCATTTTATTTCCGCAGCCTCCAGAAGAGCGGTCGTGTGCAGGGTAAACTCTTTTGGTTAGCTCTTGGT
GGGCAGCGAATCGCGAGTAAGGACGTAAAGTTGAACACCACCGTTAACGAGTTGGTACAGCACTTCATAAGCTTCATGGAGAAAAACAAGAAATGCCGCG
TGGCTCGCTGCGTCTCGCTTTTCATCGTTGACGAGGGTGGGAAGCTGCAGTTGTGGCGGACATCGACTTGTGAAACCATTTCTGGCGCAGCGGCTTTGCC
TTCTGCACCAACCTTCCCCGACGCGCTAGGGTCGTCGTTTCCAAGCACTTACGAGGGACCACGTGCCATGAACGAGAGATTACTGGCTCGAGCCCGTGCT
GAAGGCAGGGGTCCTGATGAACGGCTTGTTGAAGCTATCATGGCGACCGCAGCACCTCACCTCAACAGAATTACGTCGCGGTTGCTGCCAGCAGCATCTT
CCAGTACACGTTTGGACCCGCTTGGAGAATCGGAAGGCAGACGTCGAGCAAACCTCCAGCTTCACAGTTCGACGGACTGGGATGAAGCCTTGTCTTTTCT
TCCAGCTACGTCTTCTCTATCTCGAGGGCGACGACGAACAGTGTCGGCAGCTCATCTCATGTCCAGCCAGAAGCGTGGTTGCTGCGGAGACTTTTGCAGC
ATGTCAATCGCCGAGTTGACTGCTCGGCGTTTGGAACGCAAAAAGGAGCCCACGTTAAGCGAGCAAGCAGGCCACGCTAGGAAAGGCCGGCGACGGACTA
GTGTCGCCACCGCCGCGGCTGTTGCAAGTGCCTTCATGGAGTCCCGTCGCACGAACGACTTGCTGTTTCGGTTAGCAGAGCAACGCAAACCATCGTCGCC
ACAGCGACTGCAGCGTGCCGAGACACAGCAGCCTCAGCCACCAACGCACACCATTCCGTTTAAGCTGGTCGCACAGACTCGGGCTGAGAAACAACTTGTA
GATCTCTTCGTTCGACGGTACCAGAGTGGTGAAGATGGCGACTATCTTGCAGAAGCCTACTACGGAGATGGCGAACCTCTCGGAGTCACGTTTCCGGGAT
ACTATTACCGAGACGTCCAGGTCTGCGCCAACTGCTATGAGTTTTACACACTCGTTGAAAAGGTCCGCATGAAGGCTCTGGATCAAATCGCGCGACGTGG
AGAGAAGAAAACTAGTCCAAACCGCCGAAGTCCAGACAAACAGGATGAAAAACGTACTCGAGAGCTTTCGATAGCCGAGCGAAGAGAGGAGACTGACGAC
GATGGCAATAATGATGTGGAGTATTCAGACACTTTGCAGCATGTGTGGAAGCAAGTGTGGGCGCAAACTTCCGTCGTGGCCGCAGCGATCACGAAAAAAG
ACGCCGCTGAGCTGTACAGCTTTGTAAATCCGCATCCTGCTGTTGCGATGGTGTTGAGTGGTCTGGGGGCTTTGCTTCTGGGGTCACGAGGAGGTGGAGG
AGGACTGGGGTGAGGTCAAACGGGTGATCTCACAGGATAAACTCCTCTCGCGGTTGCATCGCGTGGATCTAGAGGGACTGTCTGAACGTGCCGTGATGCA
GGCAGCAGCTCATGCTCGTAATCCACTGTTCACACCGGCACAGATCGCGCCTATTAGTTCATGCGCTGCGAAGTTCTGCGATTGGATCCGTACTGTGCTG
CAGGCTTACGCGTGGAAGCACAGGCTGCATATGCAAGACACGGGGACACGACGTATGCTTTGCCTCCTCAAATCAGAGATCCTGCCAGCCGGCATTGCTG
CTGCTCAGCTGGAAGACGCGCAACGCGAAAATGGGAAAGTCAAGAAGGTCACAAACGATTCAAACAACGATGATTCGTCACCTACAACGCGGCGCCAGTC
TCAGCAGAAGCAAACTGCTCGACGAGCCATACAAGCTCAGAACATGACACGCCTTGCAGCACCGTCGGGGCTACAAGATGGCGTAGGAGGCGGCACTGCA
GATCCTGTATTTACCTGTCAGGATGGAGTCACGCAGATACCGTACGCAATAATTGGCCAGCCCATCGGTCCAACCGTCAAGTGCAATCTCGTAGTGTTTC
ACGACTTGTTCGACACGCTCGAAAGCACTCGAGTGTTCTTCCGACCGATTGTGGCGCGGAACGCGGGCTCACGAGCGCTGCTGTTCAATTTCCCAGGTCA
AGCCGGCTCTGCTTATGCAGTCGATGATCAAGCCCGCGAAGAAGACAAGCTTGTCTTGAACAACATGTGGCTTGCGCGCCGTGTGCACGAGCTACTCAAT
TTCTTGCAGCACACCGCCCAGTTCGTCACCTCGGGTGCTCCTTTTCACATCGTCGGGTTCGGAAATGGTGCCAACGTAGCCTCGTGCTACGCCGTACTCC
ATGGCAAAAGCTACGACGGATACTTGCAGTCACTTGCTCTTTTCAATGGGTTTGCGAGCGTGGATGCTCAGCTAGCCGCGGTGCTGCACAGCGCAGTGAA
TGTGTTTGCATGTTTGCCACCGACGCGACCAGACTTGCCAGTGTCATTCTTCTGTAAGTTTCTCTTTTCAGAGGCGTACTTGTGCAAGGTCGACATGAAC
TTAGCGCTGAGTATCTACACAGCTGTGACCAACGCCATCACGCTTGACGGGCGTATTCGCTTATGCCGAGGTGCTCTCCGTCACGCAGACCTGGGCTCAT
TGCTTGCCGAGATTGACGTTCCACTTGTCCTAGTGCAGTCAGTGGAAAACACACTGGTGTCCCCCACGAACGTAGATCCATTTCTCCAGGGACGCGCAAG
TGTGCAGCATGTATGGTCCCATCAACAACCGCATACCAGTGACCTGCGCTCTAAAACCCGTGCGCAGATGAGGAAAGCACTAGCAACTCCAAAGAGTGCC
TTTGTATCATGGCTTCGCGCTGGCCATGAGCTCCGCCAGGAAGCAAAGAGCTACGTCACAGAGGTGATCGAGATGCTAGTCAACTCCCAAACGGAGCGTT
CAGAACAAGATCGCGCGCTACAGAGGAAGCAGACGCGCGCCAAGCAACACCGACGAAGCAGCAAAAGGCAGCAGCAAGAAAGGAGACGACAGTTCCGGAT
GAGAGCCAACGTGTCCAGCCGTCACTAACTGATCTCGAGCCTCAAAGTGCTGCAATAACATCCAAAACTCCAGCTGAGCCCTTAGTTGCAGATCCAGCAG
GCAATTCGCTTCTCGTAAGCTGGTCACCACAGCAAACCAACAAATCGCCGTATGACCTTCAACTAGAAAAGTCCGAACGAGCATTTCAGGAGGCACTGCG
TACGCACGAAGCCCAGAAATCTGCGTACGAGAAGAAGAAGCTCCTGCAACAACCAGGCGCAACGCTGACCACCTCGACAACTGAGATCGCCGAAATCCCA
ATAACTCAATCTGTTGTGCCCTTGGACATGCTGCTTCCTCCTGCTCTTCCTGCTATCGTGATGCATGAAAATGATCAAACGTCATGTCCGAACGAAGACA
ATAGCGATACCCAGCTAGATGACGATATCGATGATGTACGTACCAAAATCCGTGCTGAAGAAGTACGACTTGAAAAGGAGGTCGAAGAACAGCGTGAAAA
GCATCGCGCTGCTACTGAGCAACGGATGGCTGCTCTCAGAGAGGAACAGGAGCGGAGGCGACGTGAGTGGGAACAGGAGGATCGCGAGCGACTTGCAGCT
CTTGAAGCACAACTACAGGCTCAACAAGATGAGCGGCTTGCTGAATCTCAGCAGCGGGACCTAGACCAGCTCGCGATGGACGAGGCAGTGCTTGCTGCCG
CCAGTACAGTCTTAGAAACATCAGTGTCCTCACCATCGCTGATTCTTGAGACGTCTGTCGAAATGCCAATTTCACCAAAACAATCCGCTAGTACGTTGCT
GGCTCCTTCCGTGGAGAAAACACGACAACAGATTCAAGTACAACCAGAACTACCGAGTATGTTTGACCAGCTTGAAGCAGAAGAACACGCTCGGAGACGC
CGAGAGCAGAAACGACGAGCCTTTGGGCCTGGACAGACAGCAGGAAGCCACCTAACCGGCGATCAGTACGACGAGGTACGGACTTCACTAAAGGAGGCCT
TCCGAGAAGATATCCGAGCGAATGAGTCCAACATGAAGCGCGAGTTGCGACGACGGCGTGACGCACAAGCCACACGAGTCCAAAAGTACATCCGCCGGTT
CTTGGCTACGCGTCGAGTTGATCGTATACGACGTGAAACCCAACAAGAGCGCGTCAAAAACTTTGCTGGTGGTGAAGTCGTGAGGATAGCACGGGGCCGC
TTAGGCCGTAGACGATATCGTAGACTGTTTGAAGAGAAGGAAGAGGCTGCAAGGCGATTACATGCAACCATACGCATCCAGACCGTCTTCCGAGGCTTTT
CGAATCGCAAGGCATACCGTGCAAAACTCCGAGAAAATAAGGCGTGCATGTTAGAGCGAGTTTTTCGTGGTCACCTCGGACGGAAGCGTGCCCGGCGACT
GCGCAAAGAGCAAGAACGCCGCCGCTTTCAGGACCGTAACGCTGCCAAAGTGCAGGCTACCTGGCGGATGTACATCGCGCGTGGCAGATTTCTCACTGCT
CGGTTCTCCGAGCTTGCAGCTCTTGAGATTCAGCGGATGTATCGTGGTCTTCTGGGTCGACGAGAAGCTGCACGCAAGAAGCAGTGGCGCGATGCACCGC
CTGGAGCTGAAAGACTGGCGCTCGGACTTCAACTAATTGAAGGCTCGAAGCAGGCTTTTGAACGACAGCAGAGCGAGCTTGATGCGCTTCATCGCGCACA
AGAAGCAGCCGAGCGTCAGGTTAGTGCTGTGCACAACGAGCTGCGTGAAGCCGAAAAGGAGCTGGCTGTGCTGGAGAACGAACTGCAAGAAATCGATCAG
CTAGACGCCGACGTGAGAGAACTCACACACGAAGCCGAACGACTGCACGCTGGCGGTGTCGAAGGATTGCTACGCAACCACCGATCATCGTTGCAACATC
AACCTCTTGGAAACGGTGTACCGGATACGTCTTCACCACCAGACAGCAACGCAACGACCGTGCACCGTACCAGCTTGGGGATGAGAACGCGCTGGAGACG
AGGGAGGCCCTGAAAAAGCGCCAGGCAGACGCGTACGCCGTGGAAATGGCACTCAGCATCAAACGCAGCGAGCGTGAAAAGAAGAAGCGTGACCTGGAAG
CGGAGTTTGCTGGAGCGTTTGCTGAGGTGCAACGAAAGCGAGATGCATTGGCTGCACTGGAAGAGCGGCTTGCTGACATGGAGCAGACTCGCATGCGAAA
GGATCGTGAATTTGCACGTTTGCAGCGGCATCTGATGGAGTTGCTGGAAGAGCAAAAGCTGGAGCTTGAAAACTTGCGCGAAAGGGGTATTGAGCTCGAG
ACAGCTACAGCCACCTCGGCAGCAGCGGCAGCAGCAACGGCAGCTAAAGCTCGCGAGCACGAAGTACGGTCGCAGGCAATGTTTGAATCCACGGAAGAGC
TCATGAAGTTCCAGTTCATGTCGATGTCGTTGTCGTACTTCAGTTCGCTCAATATGCTCAAGAATCTGCGCGACATCAACGCCGACACCACTGCTTCAGC
CATCACTTCCACAGCGGAGACCGCAGCCACTGCTGCTGCTGCTGCGGCTGCCGCAAACATTACTCCAGTCACCGCAGCTCTCGCGAAGAAGACGCCAGGT
GGAGATGCCATCAGCAATTTACTAACGACTGTGGCGCAGCGCAAGCAGCAAGAGCTGGTGCAGCGACAACGCGAAGAGGAAGAGGCCTTAGCACCAGGAA
AGCAGCAGCCGTTGCCTGAAGAACTACGCGCGTGGACCGTGGGCGATGTTGGTAGGTGGCTCGACAGTTTGTCATTACCGCAGTACAAGGCTGCGTTCAG
CGAAGGCGCAGTGGACGGCGAGTTTCATTGAGCTCCGTGCTGAGGACATGGCTGAAGTTCTCGGCGTCTCGCACAAACTCCATGTGCGCAAACTGCTGAC
AGCACGCAACAAGTTGCTGCCTCTGACGGCGGCGGAGCGGTCTCAACTAGATGCCGTGAACCACGAGGCAAATGCTGCACGTGCACGTGGACAGGAACCG
GCAGCAGGAGATGAAGCCTCGCTGGAGGTGGACACCGTATTCTCGCAGGCGCGCAACGGGCGGATGAAGCGGCTTGTCGAGAGTCTGGACGCAGGCTTCC
CTGTCGACAGCGAGGACGACAAGGGTAACACGCTGCTGCTGCTCGCGTGTCAAAACGTGAACCAGCGCATGGTAGAGCTCCTGGTTACACGCAGAGCCAA
CTTGAATCACCGCAATGCACAGGGCAACACACCACTTCACTTCGCGATGGCCTACGACGGTGAAGGTGTCCTTGGCGAGTACCTGATCGCACACGGCGCC
GACGACACCATCGAAAACAACAGCGGCCTCACAGCCTACGACGGGCTCACAGCGGAGTAAATGGCGTATCAATCACACAGGACAAGTTGCTAGAGACATT
CGTGCCAGCTCGCATCGTTTGCGAACTCGGGACACTATATTTTTGCTTTCCATTCTGCTGGTGTACCAATGAAGCCTTCCGCAATGCGCACGGCGATTAG
ATAATACATACTACAGCACTCGCTTCCACAACCGACTTTCTCCCTGCTCCAACAATGCCTTGCAGTGCTCCACGATCGCTTGGCGAGCCCCTTGTTACTT
TGATGCTGTATTCTCGTAATCTTAGGCGTCCACCCGAGCCTCAGTCACACCACGCACCTGGGAGGCCATCATACGGTTAACGGCGTTGACGTAGGCCGTA
GCCGACGCTACCAGGATGTCAGTGTTGGCGCCGTGGCCAACGAACTGGCGGTCACGTGTCACACCGGTCTGGGCGTTCACGTGCTTCTCATCTTCCGTCT
TCTCCTCCTCCTCCTTGTCCTCCTGCACTCGCACGGTCACCTCACCCAGAGCGTACGTGCCATCCGTCACACTCTCCACGGAGAAGTCATTCAGCTTGAT
GCTGTCCATGCCCGTAGCGCGCTTGATGGCCACGTAGATGGCGTCAATGGGACCAGTGCCCATGGCAGCCTCGCTCACCTCCTGTCCATCCTTGTGCGCA
AGCGTGACCGTAGCCGTGGGCTTGACAAGGTTGCCAGCCGTCACATGCACGGACTGCAGCGTCCAGAACACCTCGGGCTTGAACAGCTCGTCCGACACAA
TCGCCTCCATGTCAGCATCCGTGACCGTCTTCTTCTCGTCAGCCAGCACTTTGAACTTCTCCACGTAGTGGTCGAGCTCCTCCGGCGTGAGGTTGTTGTA
GCCAAGCTGCTGGAGACGCTTGCTGTACGCGTGGCGGCCCGAGTGCTTGCCGAGCACCATCTTGTTCTCGCTTAGACCCACCGACTCCGGCAGCATGATC
TCATACGTGGCTTGGTGCTTCAACACTCCATCCTGGTGGATACCAGACTCGTGCGCGAAAGCGTTAGCGCCCACAATGGCCTTGTTGGGCTGAATAGACA
TACCGGTGTAGTGGCTCACCATACGGCTGCAGCGGGTGATCTGCGTCGAGTCCACGCTCGTGTACACGGGGAAGTGCTGCGGGCGCGTCTTAAGAGCCAT
AACAAGCTCCTCGAGGGCCGTGTTACCGGCACGCTCACCGATACCATTGATCGTAACCTCAACTTGACGCGCGCCGCCCTGAACAGCAGCCAGCGTGTTG
GCCGTGGCCAAACCCAGGTCGTTATGGCAGTGCGTGGAGAAAATGGCCTTGTCGCTGCCCTCCGTGTTGTCAATCAGGTAGCTGAAGAGCGATCCGTACT
CTCCAGGGACCGTGTAGCCGACCGTATCGGGGATGTTGAGCGTCGTGGCGCCAGCCTTGATGACCTCAGCAAGAACGTCGCACAGGAAGTCGGGGTCACT
GCGACCGGCGTCCTCGGTGGAGAACTCGACGTCGTCGGTCAAGCTCCGCGCGAACTTGACGGCGTCCACGGCGCGACGGATGCACTCGTCGCGCGAGATT
TTGAGCTTGTACTTGAGGTGGATGTCGGACGTGGCCAGGAACGTGTGGATGCGGTGCTTTGGCGCGTGCTTGACAGCATCGTAGCAGCGCTGGATGTCCT
TCTCCATGGCGCGCGCGAGGCCGCACACGGTCATGGGCTCGCCCGTCGCGCGGTTGGCCGTGAGCGGGCCGACCTCTTTGGCGATGGCCGACACGGCTTC
GAAGTCGCCGGGCGACGAGATGGGGAAGCCCGCCTCGCACACGTCCACGCCCAGCACGCTCAGACTGCGCGCGATGTCAAGCTTTTCCTTGAAGTTAAGC
GTGGCGCCGGGCGACTGCTCGCCGTCGCGCAGCGTTGTGTCGAAGATCACGAGGCGCTCCTTGCCGGCCTCGGCGGCGGCCACATTCGAGAAGGCGCGGC
TCGCGTTGGCTCGGGCCGCGGAGGCCGAGCGCTTGGCGATCGACTGCATCATGTTGGTGTGTACGGGAGGAGGTCAATGGGCGGAGCAAAAGTGCACGTC
ACTGCTGCGCTGCGGATTGCGGAATGAGCCGCAAAAGTGCAACCAGCCGCTCCGGTTTGAGCAAACACGCGTACAGAGGTTGAGCGGCTGCATCAGCTCC
AGGCAATTAGATGCACCACCAGCAACGGCGCGACCGCGATCTTAGCAGGGCCTTTTGACCAATCGTATTGCGCACAACAGACTTTTGGCCAATGGTAGGG
ATGCGTAAAAATGACGTAAAAAGTCATGCGTGGCGTAAAAAAAAAGAGGTAAAAATCTCTTGGCGTGCAGGCCAGTCGCGCTGTCCCGGTGCTCAAGCGC
GAGCGGTCATACTGTATCATCAGCACTTCACCACAAGAACGTGCGCGAGGCGCCCCAAAAGTTCAATGCCGCGCGCCTCCAACACGATCATCAATATGTT
CAATCTGCTCGGCAGTTTATTCAACCTGCTCGGCAGTTCAACATGAGCGGCGGTCATGCGCGGTTCGACAGATCCCAGCAGCGACTTCAGGGCATGGACA
AAATCACCTTGGACATTAACTCCTGCTTTGCTGCAGTGCCTGCACCTGGTGGCTGCAACGCTATCACATCTCCATACCTTATCAATGGTCTGCTGCGGCT
CATGGCCGAGCACAAGCAGCGAATGAGCTTGTGGCGTCCAATCCGAGGGCCGGTGCAGCCGTCCTTTCCTTGAGGTCTCATCAGATGTTCACCTTCAACC
TGGCCTTGAACTCAAACAGCGCGTCAAGGTGGCAGTGCTTGCAGTGGCTCTCAGCCCAGTGAGCTGAGCTCACATGGAAGGACGGCTCGCATCGGAGCAC
CAGACTGCGGTGCTGAGGCTCCGATCGAACGTCTTTGATGTAGATGTACCGTCAAGGTGGTACCGGAGACGACTCTTCATTGGCTGATTATCGCATTGAC
CGTTACGCCGCAGTGCGCCATGTCCTCGCCAAAAGCATAATCGTCGTGGAGCCCGTGGTCTTGGAGACCAGTTCCGCTCCGGATGGCGTCTCGGCCGCTC
GAAATGCCCTCGGGGCGCATCGCCGCCCGCCCCCCAATGCGGCAGAACGTGGCTCTGCGTTGGGTGAACGCGGTTGTGCCAGCTTCGGCCGCATCCAAGA
CCTCGCCTTCGCCCATAAAGAGATGGCCTCCCCCGTCGAATGTTGAAGCCCCGCCTCATGCTCCAGTGATTGCAACATCGATGCCAGCGCCTGCAGTGGA
GAAGAAGAAGCCGGTGTCTGCGGGATTTCAGTCTGCGCGCGCCGTGTTCGAAGCCAAGAGAACTACAACTAACCCGCCGCCAACTCGTCGCCGATTGCCG
TTCCCCGCCCCACCTGCGCCTGCAGTTGTGAAACAGCACTCGGTAGCATCGGATTTGTCCAGCTCTTCATGCAGCACGGTAGACTCCGAGAGCAGCCGCA
TACTGGAAGAAACCATGGAAGCGCAGCATGAATTCATGACACGGTCGCCGGTTCGGCCAAGCGAGGCAAAAAAAGTGGAAAAGAAGTCCTTGACGATCAC
CTCTTCTGTTACCGCAGCAGGCCCTGTACCGCGATCACCGCTTCCAATTAAACAAGCCGCTAGCTCTCACATACCTGCATTGCTGATGACAACATCCGCG
CAGGCGAAGCAAGGACAGCCCAGTATTAATGCCACCATTGATCCATTCCAACTTCTTCTTCCAGTTGGAGCGGTACCAACACTTCCCGATGAAGTGTCAT
GCGTCTATGACAACGCTGCGATTGAAATGCAGAAGGGCGTCAAGAAAGTAGTGCGCAAGCTGCTCAAGAAAAACAAGGCACGGCAAGAGGAGTTCAAGGT
CAATTCCCGGCTCTTTGGAACCGATTTCATGGACTCGCAAGCTTATCTGGACACGCTGATCAAGGACTTTGGCGCAATTCGTGCCCTGCAACTTGTTCCG
TGCTTGTTGAGCATCCAGCCCGATATTCTGAAGAGCAAGGCTCTCCTTCTTACCGCCAAAAACTATCTATTGCGAAACGAAGAGTCATTGGAGTGTGAGC
TGCGGGCCTTGACGGCACCAAGTACCAGAGATAGTGCTAAGACTGATGGCGTATCAGTTGTTGGCTCTGTGGCCATCCCGCTCCCAGACGCTGAGGTGAA
GACTCTATCGCCAATTATCAGAACTGCGTTGAAGGTGCCTGCACACGCCTTGGCGGCGGGACCTCAGTCGAGAGAAGAGGTCAACTCCACGGCTACAGTC
TGCACCTCTATGCCTGACCATGTCGATACTGTCGATAGTGCTGCCGGCAAGAACGATTCTGCAGTGTTGCCAATTTCGGCTTCTAAAGACATAGTTTCGG
CTACCATTTTGGCGCTGAAAAAACCGGAGTTCACTAGCCCACCAGGAGGAGTATCACCAGCGACCACTATCCAGTTGGCTGAACCCATGCCAGAACCTCA
AGAGGCAGCACTAATTGGGCCACCGCCCCATGTGACCAATATTGTGGTGAATGCTCCCACGCCGGCGACGACTACAGCGGTGCGCGGGATTGATGCCAAT
CCAGTTATCAAGAAGACTCCGAGTCGGATACTCCAAGCGACAGTGGGGATGAATTTCGTGCCGAAAATCTCTTCGGCGAGCCTATCAATCCTACTTCTCC
GCAGCAACAGCAGGAAGTAGCTGCCATCTCCCCGGTGTCGTCGACGCACAGTTTCGACGAAGCGGAGAGCTTGTTCGGTGAGCGTCTGTCCTGCTCGTCT
CGCTCCAGCACGAGCCGGCGAAAGACTGTAACATGGGGCGAGGCCAAAACAATGGAGGTCCCCGTACAGCGAGCCTCATGCATCAACAAGAAGCCGCCCC
GCTTATTTTCGGCCTTGCCACCGCAGGCGCCTTCGACTCGGACTCGGACGACTCAGACGTGGCCTGAAAATGAAACATACTCAAGTGTAAAGCATTGTGT
CGTTTTGCCTTGTCGAGGCAACGCAGCTTGCACCGACATGACAGAACGTAGTTTCACATATTCTAGCACACAGGTTGAGGTTCACAATCCCTCGACAAGC
AAGATGTCTTCGCCTCAAATGCAGCCGCGGCAGCGGCCTAGCAGCGCCGCGAGCCTCCACGGCGACTTCCGGTGGAAGTGCTGGGCAGCCAGGAGTCTCT
GGACCTGGACTGCGGCAAATTTTACACGGCAAGTAGTGTGTGTTGGCCGCTGTAGCCACGGTCTCCCCAGTCTCACCTTGTACGGCTGCAGGAATACATC
CTGCGCTGCTCGTGGATCGAGCGCAATGGGACGCCAGAGGTTCGTTGAGCAGCAACTTCATTTGCATGGCATTGAAAACAGGAGACTGAATTGGGCGACG
CTGGTGCACAGATTTGGGACGTCGTGCGACGGTACCGCGAATTTTGCGCAGTCGACATTTTGGTGAGAAACAAGGAGCAGTCCACGCATTCGTCACGTTA
TACGCTAACAATGTATGCAATACCTATTGTGTGTATTTGCAGCTGCGCGAAAAGTATCCGTCGCGGGCGCCCATGTTCCCGTATCTGCCGAGCAAGAAGT
ACATCGGGTCGTCCCTGTCGGCCGACTTTGTGGACAAGCGGCAGCGCGACCTCGGCTACTACATGATGTCCATCCTGCACAGCTGCCCGCTGGTACGCAC
GTGCTGAATTCTATACGCCTGATGCTCTTATTACCCGCCTATTGACACGATTGGTGTTGGTAGCTCGTTCAAGACGAGATCATTGACTCGTTCCTGGACA
TTAAGCGGCACATTTTGGAGCGCGCGCGGGAGGAGTTTAACGACAGCCGCTTGGCTTCTACCCCCACGCACACGACGAGCAGCAACGGCGGCATGAGCCC
TGCACGGCTGCAGCTCTAGTTCCATCAATTCAAATACACTTATTACTTTTGACCAGATCAAGTCTCGTCCCCTCGCTCAAACAGCAATTTGCCGAGAGAA
GGAAACGAGTATACAAAGCCCCATACAAACCATAACCCCCTCTTTAATCCGATATGGACCATCACTCTGCGCAAGATTTAGTGGCTGCACGCACAGCAGA
GCGAGCTCCGGACCGGCCTAAACGTGGCGCGGCGCGAGTAAGTTTGGAGCGTGTTCGTTACCAGTCCCCGCGCGAGTGTACGAGCGCTTCCAGTGGACGA
GAGCACAGCCGCGTCAGGGGAAAAGGGGAGAACATGGCGCTCGCAGACATCATGTCGGTGGAGATGAGTGCCAAATACATGGACTCTAGCAGCTCATCGA
GTCTGTCGTCGGACTCGGACGACGTGTTGTCGTCCTCGAGCTCTTCGGCCGTCTCGTCGTCGAACTCGGAGTCGGACTCGGACGCGCCGCGAGCGTCGGC
CAAGAAGAAGAAAGCAGCAGGTCCTCGAGGACGCGCTGGGAAGAAGGTGGACGTGGCGCTCTCGGACTATGAGGACGACTCGGACTTGGACAGTGCCACT
AGTGGAGGCAGCAAGAGGAGGAAGAAGAAGAAACCTGCAGCACCCAGACGGTCGCCGGTCAAGAGCAACGGGAAAGCCAAGAAGACGGAGAAAGCGGCTC
CTGTAGTAGCGGCGCCGCCGAGTCTTCCACCCCACCTCCGCCTCCGTCGCCTCCTCCGGCTGCACCAGATGAGGAATCTTCCAGTAACAGCTCATTCAGC
TCCAGTTCCAGCTCGGACTCGTCGGAACTGTCGGACTCGGAGACAGCGCTCCCCGTTCCCCCGCCACTCCCACCTGCGGCTGGTGACGCTTCTCCTGCAG
TGTCTGCGGCTGCGAGACCGCCGAAGCGGAGAGCTTCGACCAAAAAGAAGGCGGAAGTGAGTCCGTCGTCGCTGAAGGTGACGCTGAAGCTCCCGCCAGG
CTTTATTGCAAAAGGCGGGGGAGCACCTGCAGCTAGTAGTCGAGCTCAGGTGAACGCCCAGGCGACAGACGCGATACCTAAACGACCACGAACGCCCACA
GCTACAGCAAAGGCTGCAACAAGTTTGCGGTCTGCCAAGAAGAAACAGCCAGCAGGTCGTGCCCAGAATTCTGTTGTCCAAGCGAATGGGACGTCCCCCG
CAGTACCGCTCGTTCCGGTTAGTCCTCCCGTTTTGCCCAAGCTGATCCCCACTGGTCCGACGGTCCCTTCAGGCGAGGTCCGAGGTGCGAAAGAGCTCTC
GCTTGTGGACCCGGCCCTTGCCAGAGACAGACCCGAAGAAATTATTGAGTCGAATATCCCGGCACACTTCAACGACGCTTACGCTCACGGAGGCGATACG
CTGCGCCTTTTGGACATGTTCTTTTTCTGCGATGAAAACGGGTATGGCGAAGCCTCACTCTTTGTTGGATGGAAGATGAATTCTAATATCGTTGTTTTCC
TCGTGCCGCTTGTTTCTACAGCAAGGCTATTAGTCTCGAGATTTTAGACCGACCAAAAGATCAGCGCCCAAAATCATGGGGTTTGGAACACTCGTAGAGC
ATTTGCCACTAGCGGAGCGTCCGCTTCCAATTCGGCCTATTCTTGCGTCCCCAGCATTTCCCTCGCGCTCCAAGAAACGCCCACGCGCGGATTCCGCCTC
GTCGACCCCTGCAAAATCCCCATCCGCTAAAGCAAGAGCGAGGCCCAACAGAGGTAAACTGTCGTTGTTGCTGCTGTGTGTCGAACTGGTAATGCGGTTT
TGCTTATTGTTTGCCATGTCCTAGCAGGAGCCAAACAAAATGACAGCAAACGCCCAAAAATTGAGGATGAAGCCATTTATCAAGGCGATGGTGAATTCGA
AGACAAGAGAGAGAGGTTGCTCATGCAGCAGATTCCTGCATTTTCCAACGGTCGACCGTCTATCGCTTTCCTAGCCCGTTTTACCCGAATCAATTGTCTC
AAATGGATGGACAATCCGATTCGGATAGTGGTGGTAGCGATTTGACTTCAGACGACGAGGATATTCGTTCTGGCCGAAGTGGATCTGGAGCTGGCTCCGA
GAACGACAGTGAGCTCCTCTCGTCCGCCACCAGCAGTTCGAGTGGTAGCGGTAGCGACAACGAAGTAAACTCGGGCAATTCTTCGTCATCATCCACTGGT
AGTGGTGCTGAGAGCGGAAATGGTACGACGACAGCGAGTCGGCGCTCGTCGGCTACTACCGGCAACCCGGCGGTCATTAAGGCCGACCACTTTCCACAAC
GAATTGCTGAACCAGCAAGACCTCCAATTAACAAAGTGCAGAGGCGACCGAGCACCAGCGTGGATTCCAGAAACGCGGGCTTGCCGGCTGATGTAGTCGG
ACTTATGCGAACCGACCAAGCCATTGACGTCAATGCAAAGGGCACTCCAGATGAGCTTAATTTGATGGAGTGCGGTTTCAGACACCCGTCTAGCTACGCT
CGCACTCGCGTTTGGCTTCCTGAGATCACGGATTGGTGCCTGGACTACGCTGAGGGGACCCAACACTGTGGGTTGTCACGCCTCATTCCTGGTACAAGAT
TGCAGGCCCGCTGTCTGGACTGCTACCTCACTCATCGTACCGTCATACTTTCAAGCATGTTCGTCATCTCTTTGAGGCAAGCTACCTTGTGGCGTACGTT
CTAAAAGAATGGCTGCCGATTAACAAGAAAGTGTCCTATCGAGCCACTCTCCAGCAGATTATTGAGCTGTCTTTAAAGGGCAGATTTCGAGTGGTACGAC
TGCATACTGCATTATGTTGGTGGTGTGAGGATCATGACTTATCGTTGTCTAACGTTGGTGTTGTTGATAACACGTGTGTTTGTAGTCTGCGTGGTTTCTT
GTGAAGAATTACCCGTTCATTCGAGCCCAGATTTCAAATTTGTTTCCAGACAAGGAAGTGTATCTGGAGTCAATGTTCTTTAAACAGCTGCATCGCCTGC
ACGAAAACTACACGCTACGTGAGGCAAGACACCAAAAGGAGATGGCCGAACGAGAGGTTCGACGTGAGAAGCGAGAAAACGAACGCCTTCGGAAGAGACA
GCGAGTTGATGATGCGAGGCAGCGCATGATGGACGAGCGTGAAGAAGAACGAAAACTGAAAGAGCACGGTCAAAAATACCCTGTCGAAGATTTGCGCTGC
TCGAAGGAGATGCAGTCAACACCAACAGCCTCCCTTTGGCGTGCTCGAGTCTAAAGGGAGTTGAGGGCCCTCTTCTCGGTGAGCTCATCATGGCGTGGCA
AACGATCAGCACTTTCAAGGATTTTGTGGGGCTTGAATCGATTTCGTTGGAGGCACTTGTGGAGTGCATTACGACTAGTTGCGACGAAGGCACCCATGTG
GGATTAGCGCGGATTTTTATGGCGTTCCTCCATGTCATCTTGTCGGAAAAGTCGTTTATGTCGCTGCTGGATGATCTTGTTGTTGAAGGTAATATCAAGG
TCTCAGACCTGTTCGTGAACAGTGAAAGGACTTACGGAATTTGCGAGCGTGCCTACGGTGACATGTTGAATGCTGTCACTTGGCAAGAGATTCTCCGTCA
ATTGATGTCCAAGGACATGGGAATCGACCCATCTATTGGCCACGCAGAGCCTTTAGTTGGGTGTGAAATCGTCCGGCAGACGCTATACATGCAAACCAAC
TCGACACCATTCAATACTCCTGTTGACACATCCGCCAAGGGCCTAGAGGATTACTCGCAGATCATCAAACACCCAATGGACCTGGGGACTATCAAGAAGC
GAATTGATTCAGGGGGATATGAGGGGTCCGACGGTTACGAAAAGTTCGCGGGGATATTAGACTGGTGTGGGATAATGCTGTACTGTACAATGGCGAGGAG
TCAGAAGTAGGGCGCACTGCCTTAGCATTGTCGGACGTCTTCGAACAAGATTACGAGCGTTTCGTGATCGGACGTGTTCGTGCAAACCAAAGCAGGATGG
AAGCGTGCAAGAAGGCTAAAGAAACGCTGCAAGACTCATCAGCAGAGAAGGTCAAGACGTTCAAGTATGCCGACGTTGTGTACGGCCTCTATTGCTTCGA
GTTCCACGAACTTCCGACGCCGTACAAAATTGGTGCTCTTTCGTGGATTTGTTCAGAATTCTTGACCCTTTCTAGCATTCGAACCTACATGGCATCTCAA
GTGGATCAGGAGATGCTGATTCACAGGAATCATAGAAAGCGCGCAGCCGATTTGGACTCACAGAGAAAGCACTCCGACAAGATGCGGCGTGAAAGAGAGA
ATGCCTTTAGAAGAGATTGTGCTAACCAAGGCATCCATCCCAATTCGCACAACGTTTTCTCGGAGGGTATTAAGCGCAGGCACGAATTTATCGGCAAATT
TTTCGAAGACATTCAAGCAGAGAAAGCTGAGGACGATAAAAACGTGGAGCAAGAGAAGAAAGTTCAGCAGAAGAAATGGCGAGCGAACTAAGCTCAATTG
TTATTCGTGAGGCCCCCCTAGGGAAGACAGATACCACAATTCGTACTATATGTTCAAGCATGATACGAAGCCGCGGTTGTTCATCGAGCGCGGGGATCTG
GAGAGTTCGTGGTTTGTGCCAGCAAAGCTCAGCTTACGACAATTCTGGAGTGGTTAAACCCTAAAGGAGTTCGGGAGCTGGACTTGTTGACGAAACTACA
CGAGGTGAATGATAAGCTACTTAGTGCCTTCGATGAAGAAGAAGGCAAGCAAGACGGAGATACCACCACGGAGTTGGTATGGAATGCTAAGGATGGTATT
GAACTCCAAATGTTCCCTCTTCCGGGTGGCGCTATCAAGAGTGAACAATGACTATTACAGACGCGGACAAGGTCATCAAGTCACACAACGTGACCCGCAA
AATGTTACTTAGTTTGAAGCAGCATTTAGAGAGCACAAACACGCTGCCTGCTTCTTGGGAAGGTTCTGAGACGTGGAGTGATCGTGTGGAAGAGGCAAAG
GTATTCAAAGAGCAACTCGATCTGTTTGCAAAGCTGGAAAATGCTGCAGTGACAGCCCTGAATTCAGGCGTGGAGACAATCAGACCTTCATGGCAGCGGA
AGCGACATGAGTGGCGGTTGGCACTCGAGGGTTCATGTACATACGCGCAGTTAGTGTTTCTACTGCATCTGCTGTTGGAGGAGTTCATTAATGTGGAGGC
TTTCATGGATCTGCACATCCGACTTGATCGGCGTGAATGGCTTAAGCTTCGACCTAAGGAGACTCGGAACTTTATTCCTGAGTCTGGAAATGTTGTCGTA
TACTTCGGAGATGGCCATGCTCTGGCGCTAAAAGAAGACGAGAAGAGCAAGAAAAAGCGCTTCACACAGAAAAGTGATACTCCTGTTCGAAATGCAGCAG
TTGTCTGCACGGTGGAGAAGGTATCTTACCACCACGGCGGAGGTGACCCGTATGCGTTGGCGGTATTAAAACCTGTCTCGGACATGGCTCTGCACGAATG
CATTCGTAAGCCTGGAGAGCTCTTGTGCCCCCTGCCATCGCGAGAACAAAGGCTTGCGAGAGTGTTTCTGCGAGTTTTGGCTAAGCTGAAAATGCTAGCT
GACGCCGGACCGTTCCTTGAGCCTGTGTCTGATCGGGAGTTTCCACAATACAAGGAAATTATTCCTCAGCCGATGGATCTTGAAAAAATAACCTCCAAGG
CAAGCAAGCTGGAGTACAAGAATGCGGTTGAGTTCATGACTGACCTGAGGCTCATGCGCGATAATTGCCAGCTCTTTTGCGAAGGCCGCTTTCCGACACT
GCCGCCGTTGGCCCACAACTTGGTAAACGTTGCGGATGGACAAATCAAAAAGTGGGGTAAGGAAATTCGTGCGTGCGAAGATAACTTTGATGGCTCGTCA
TCGATGAAGAATAGCAGCACGCTGTCTCCGGAAAAGAAGGACGCTATCAAGCAAGATGAATTAGACGGAGGAAAGACGGAGTTGCCAGCCCGTTCGATCA
TGGCAATTTTGCGCCTCGAAAATCGATTGCCCGAGTACATTGTGGATATTAGTCGTTACGCGTGGGCGGTGAACCGTACATGGCATTGTGGAGAACACTT
TCGTATGCTGTTCCGCAACCCACAAGGGTACCCAGGCGAGTACTACGGAGGGGTAACCGCAGGGTCCTTGCCATTTGATGATCACGGAATGCTGCCATGG
GAGGCGCTGCGTATTACATGGGACGAAGATGACGGGTCGGACGACAATCGCATTAACCCATGGTTCGTAACTTGGCTGGTGTACAGGATGCGATGTTTGT
CTGATTTCTCACATTATTTAAACTTGTCTGACGAACAGGGAAGCGGAGTTTCCTCGGGGTGGAAATCGGGCGTAGATAGAGATAGATGTTCCAAGCTCTC
GATTTCGCTTAGGCTGATTAAAGTGCTCA