Description :
From Genome Similarity Track
Location :
contig_3:25525- 26727
Transcript NameFunction/comments
g878.t1hypothetical protein

Sequence
1202 bases(100 bases per row)
ATCGCCAACGTCTCCGTCCTCAGACGCGCTGGTTGACGAGCTTCCGTACGTCGTCGTCGATGCCGGAGTAGGCGACGGCGTCGTTTTTGTAGACGCCGGT
GTGGGCGTAGGGGTCGTCGTCTTTGTAGCTGCCGGCGTGGGGGTCGGCGTCTCGGTCGTGTTGGTCGCCGCGGGGGTGGGCGACGGCGTCTTGGTCTTGG
TCGCCGCCGGGGTGGGCGACGGTGTTGTAGCCGCTGGGGTTGGGGCCGGCGTTGTAGCTGCTGGCGTCGGCGTGGGGGTCGGAGCTGTGGTTGTAGCTGC
AGGAGTGACTTCGGGCGTCGTGGGGGCGGGCGTAGGTTTGTCTCCGCAGTCGTAGAGGTCACGCAGCTCGGTGGTCTGCACGAACCAGCTCTCATCGTAG
TCCTCATTGCCGTCGAAGGATCCCGAGCCGTCCAGGTCCACGGTGTCCTCACCGTCGTAGTCCCACGTCGCGCACTTGTTCTCCTCGGGGACGTCGCTGC
AGCCAATCGTGGGGAGGACGCAGCCCCACGTGTCGCTGGTCACGAGTTGGCAAACGGCGTCTTCAGGGGCAACGCAGCTACCGCCCTTGTACGACGGCAG
GTACGAGTGGCAGTCGGCCACGGCCACGTCGCCTGCTGTGGGGCAGCTGAAGCCCACGGGCGACGACCCGGAGCCAGCGCAGAGCGTGGACGCGTCCACC
GACAGCTCGTACGTAGCGTCGCGGCACACGCTCACCTCGACGGCGGCGCTGGAAGACGAGCTGAGCGCCAGCGCTAGAAGCAGCGCGGGCAGCATGTTTG
TGTGGGAGTTAGTGTGGGGGAAATGTACCGGCCAGTTTCAGCGGCGGTAGCAATGCGGGTCTCAAGCGAAAAGCAAGAATGAGCCATGGGATAGTCGGAC
CGCTCCTTGAGTTTTCGGGTATGTGGCGACAGGTGTCCACTGTGATCACTGCGGGCCGCGGATTCGCTGAAATGCCGAGAAGAAAGTATCTGATTGGCCA
ACAAAATTTGAGCGCAGGTGGCGAGTGGTTGGCGAGACGCATTTTTTGCCACATGGCCGAAGCGATTCAGAGCGGCCGATAATACATTGCGTCTTGGTGG
CACCGTTGAATGATGCAGCTAGGATCTCCACTGTCGCCGCCCTCGACAGCATCGGACACCGAGCCTAGCCTAGCGAAACCATGTTCGTTCGCGAATTGCG
AT