Description :
From Genome Similarity Track
Location :
contig_120:25522- 27070
Transcript NameFunction/comments
g13408.t1ETP28276.1 hypothetical protein F442_22435 [Phytophthora parasitica P10297

Sequence
1548 bases(100 bases per row)
TAGTTAGTGCTGTTGTTGCGGATGTAGTATGGCTGGTCCTGGAACTCCGCCTCGCAGTACGAAAACAGTGTATCGTCGTCCGATGGCGTGAAGAGCTGCT
TACCGGCGTGGATCATCACGTAGCAACCAGTGACCGCGCATACTAGGATCACCAGCATCGATGCACCCTTGTCCAGGATTGACATGCTCTTCCAGAACAC
GCGCAGGTAAATGATCAGCGGCATGAGCAGGCAGCTCGTTGTGTGGCAGTGGCGCCCGTGAAGTCCTCCAGGTCCAGGAAACGCTTGCGCGCCAGCACGG
CGATGATCACCAGAATCACAATGATGCAAATGCGCAGGGCGATGTAGCGCAGCGGGTTGTTGCGGTACGGCTCGTGCAGCTGCTCCGCCGTGATCTCATC
GCCGAACTCGAGCGCCACGCGCAGGTGCGACATACGGCCCTCCGACTTCTCGACCAAGCTCGAAGCAGACACCTGGCGGTTGGCCGTGTCCATGGGCGTC
GAGCTCTGGATGTACGAGCGCTTCTCCTGGATCTCCAGGTCAAGGTCCACGTTCGCCTGGTCCGCCTCACCGTTGAAGCGCACGATCTCGGGGCCCTTGT
GCATACCCAGAATGAGGCGCTCCGCCATGTAGAACGGCGGCATCATGAGCGTCGAGAAAGCGATCGAGATGTGCACCTGCATGAACAGGTACGACATCAC
CACAGCACCGCGGTCGGCACTGAAGCCCAAAGGCGCCAGGCCAAGCGGGTCTGACGTGCTCACGATCGAGTACAGGATGTTGCCCGAAAGCTGGCAGCCA
CCGGCCGTGTAACCAGCCAGAGCAACAGCGATGAAGAAGGCCGAGATGAACAGAATGGTGATCACCACCACACGCGGCATGCGCTGCGGCTGCGAGTGCT
CACGCTGCAGATCGGGCACGACAATGGCAGCACCGTACGCCAAAGCAAGGTTACCGAAGCACGTCAGCACTTGGTGCAGCGTCACGTCTGGCGACGGGAT
CGAACCGTGGCCGCGCATGTTCCACTGCAACACCGACACGGCGATGATGTCGGCGATGACCGTGCCCATGCAACCGGCGAACGCCATGCCTGCGCTCTCC
TTCAGCGTCGGGATTAGACAAACTGGGATGACCATGAGCGCCATGAAGATGATCCAGAAGATCTGGCTGAACGAATCCGGGAACAGCACGTCCAGCAGAG
TGCTGCCCAGCACCAGGAAGGCGATCGGCACCAGCAGACAGACGCCCATCTGAGAGACGACCGTGAAGAAGCGGCCCCACTTGCCCAGGGCCCACTCGCC
CAGGTCACCGTACGTCTTGACGGACGACGGCGCCACCAGCATCACCTTGGACAGCTTGAGCGTAGCGTACGTGTTGGCGAAGATCATGAAGGCCAGCGCG
ATAGACGCATACAACGGGCCGGCGCGAGCGTAGTTGGAAGGCATGGCCAGCGAACCGATACCGCACACGCAGCAGAAGAGGTTGAAGGACGCCTTGGCGT
CCTCCATCGTGAAGAAGGCAGTCTTGCCGTTGGCGGCCGACATCGTGG