Description :
From Genome Similarity Track
Location :
Scaffold_35:255211- 256768
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_08013Hypothetical protein

Sequence
1557 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGAGTCGGTGTCCCG
GGAGTCGTTCTCGATCCGCGAGTCGCTCTCGAGCAAGTTTTCGCTGCGTCGGTCCAAAAATTAGGAAGTAATACCAATAACGAGTTAGCCATTTACACTT
ATATACTCGACAAATACTACAGTAGTACTAGTATAGTAGTAGAGAGGAGTTGCTGCACCAAGAATATGATACATATATCTCATTGGTTGCACACACGGCT
GCGGTTCCGTCGCCAGCTGCAGTTGCGTTGGCTGCGGAACCCTAGCCCGACGAGACTAACCTAAACCTAAGCGTCAAAGTTAACGACCAAGCGGTAATGG
CCGCGATCGCACGGTCCGGGACGTGGCAGGTCGGGCGACGTCGCACTGCGCAGCGACGCAGCAAGGGCGCGCAGTGTGTCGTAGCCGAGCCAGGCGCGGA
TGATGTCACCGTCAACGGTGACCATTTCCAGTTCGTACTTCAAGCCGTAGCCGCCTC