Description :
From Genome Similarity Track
Location :
Scaffold_4:255210- 256339
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_19228Hypothetical protein

Sequence
1129 bases(100 bases per row)
GCGCAACGAGCTCGCGTGGGCCTATGATGCTCCCTCGCGTCGTCGTCGCCGGCTGCCGAACGATCCCCGCACGTTTCGCCGCGTGGGACGGCCGTCCCTC
GCCTGTCGTACGCGGCGTTGCGGCATCACTCGAGCGACGTTGCAACGTTGCAACGACCTCTTGTGCCTCGTCGTCGGTCCATGCTCTCGCGCCTGGTCTT
TCCACACTCGTCGAATACGCTCTTCGTCGCCTGGTGGGAGCACCGAAACCAAAGCACAGTATATCCAGATTCTCATCGCACACTATTTCCGTTGGTCGAG
ACCGCGCGAGACTTGAACTTTCAGTCGAATATTTGCACGCATGGGTGTGCTCCTCCACAAGATGAAAGGCATTCTCGCGTCGGTCACGTCGTGCATCGGC
GGCACGCAGGAGCGCTACGTCGTCTGCGTCAAGTCCTCCGAGCGCGGCCTCTGGTACGTCTACAAGCTCCACGCGGACTTCGTCGCGCTCTACGAGACCC
TCCTCGCGCTCGCAGCCTCCTCGAGTTGCGCGCAAGAGTGCTGGCTCGCGCCGCTCCTCATTGGCCTCAAAGCGAGCCTCGACCCGACCGCGGGCGAGAA
GCTCTCGAGCCTCAACTCGTTTCTGCACAAGCTCATGGCGGTCCAGTCGGCCGAAGCGCACGCGGACGTGTGCCTCCTCCGGCCCAAGATCGATGCGCAG
CTCAAGACGTTCCTCGAGTGGAAGCACGACTGCAGCGTCGGCGTCAAGCGAGCCGCGGGCTCCGAGTGCATTGTGCTGCAGCCGCCGCCCGGCGCCTTGC
GACGCACGACCTTTAGCATCATCCAGTCCAAGGTCGTCGTGCCGACGCCGTCCCACCCCGGGTCGCCGCTCAAAGCGCGTCGCCTCCACGACCTCGACTG
CCGCGACGCGCCTGCCCGCCGCCGCGTGTACACCGAGGTCAACTTTGACGGCCTCTAGACACGCCGTATTATTTAAGCCAAATCCTATTTATCCTCCTCC
TCTCGTGTCTTGTGTAGTAATCAATGGCCTTGACACAACGGTGTCAATCGTCCCACGCGCGGCTGTCTGCGTGACGGGGCAGCTCGCGTTGACAGCGCGG
CGCCCCGACTCAGATGCGGGGCGCCGCCA