Description :
From Genome Similarity Track
Location :
scaffold_60:25519- 28019
Transcript NameFunction/comments
Pl_110805hypothetical protein PHYSODRAFT_473651

Sequence
2500 bases(100 bases per row)
TTACCACGTAAAACACGCTGCACGCAGCAGACGCCATTTGCACGCCAGTAGTTGGGGGTTGCAATTCTCGCAATTGCAGACAACTGTGGTGCCGAGAAGT
GTGGACTTGAAAGTGGGTACGGCACTTCCAAAGTGCCAGGCCAGACTCTGGCGTAGACGCAAGCAACAAGCACGATTGCCTCAAACGAAGGCGCTTGCTG
CTTGCAGGGACCAGTCTAGAGTGGTATGCGTCTGCTCCTAGCCGTGAATACCGGGACACCTCTCTATAGAGAACGCAATTTCTCTTGAAGAGGGGATTGA
GTGAGCCCTTCGACTAGGCGAAACTTCAGCTCGACTGGACTTGTCTGGACTGAGAAGTTTGCTGCTGGCATGAGTGATCCCTGCACCACCAGGATCGTTG
CAGCAAGTGCCGGTCGCTCGGCTGGGCGGTGCCGGGAGAGACGCTTGCGAGAAGCGAGACGAACCCTCGCGGCTGCCCGGCTAGAGAAGAATGTATCCTT
GTCAAGGAGTCTTGCTAGCTCGGAATGGATCCATCTCATGCTTTTAGCAGCACATGTAGCTCTAACTCTGTCAGGGAAGCTGATATCTGCAGTCCAAGCT
CGTTTAAATTGCATCGCGGATGTTTTCAATACAGACGGAACCAACTACCCAAAAACTATTGTGCGCATCCAGGCTGATCACTCCTCCATGTCTTCATCGT
CGGCCTCACTAACGGGACGTCGGCGTTGCTGAGCCTCAGCCGCATACAGCTGCCGCAGCTCTTCAGCCGTCTGTGGGGGCTTCTCCATCAAGCGCTGCAG
CTTTCGGGTCGGGGAGCAATCTCTGCCGCTAACTTGGCAAGAGACTTCGTACGCTCGTGCGTACGCTTGGCTTGCAGCACTAAGATCGCCGAATACCACT
TGGACCTGCGCCAGGTTGTCATAGTAGATGGTTTTCTCGTGATGAGCTGTGGGTACCACCACGTTCATGTAAGTGATAATACGCTCCCAGATCTGAGCCA
GCGCGTGGCGGTGCTGTGCCATCTGTGCCTCAGCCTGGAAGGCAGTAGTGGCAGCAGCCTCACAGCCGATATTATCCAGCGCCCAGAACAGCAAGTAGTG
ACGCTCGTGTAACACACCGCGGCGCACAACTGCATCGACCTCGTCAAGACTCTCCGGGAAGCCGTTCTCCAGTAGCTCCTGCTCCGCCGCCAAAATCCGC
GTTTGCTCCGCGGCATCCGCAACCTTACCACACGTCTCGCATCGCCACTCAAACTGCAATTGGTCTGGTCCAATGTTGCTGCCTCGCACGGGCCATGGCA
TCATGATTCCCTCTGGGCAGTTTCCAGATTGACAGCGAACAGAACGCGTCGGATCCGGCATTGAGACGCAAGCTTCACACGTACAGACAAATCCGTACGA
CTCCAGCAGAGACTCCTGACGCTCGGGTGTCGGCCTGTAGAAGAAGTTGCCATAGTCGATTGACAGTGCGTCTCCCGGTGCGATTGGACGGATAGCGGTC
ATCCACAGTGTCGAGTCGAATGTCGTGAAGCTGCAGTTAGGCAAGCAATTATGCTCCATGCGGCACGCCGACAGGAAGAGTCCAGATCCTCCAAGATTCT
CCAGTTCGTGCGAGTTGGTGTTCAACACGCCGATGAGTGTAGCCATCTGTTGGTCTGTGAAACCCGCGGGGAAGATGTCCGGTAGCTGACGGCGCAATTG
CAAGGCTGCGTCCGTCGCTCGTTGATGCCCGGCACAAGTCAGACCCAGCACTTCGTCCAGAGCGTGGGCGTCGCGTTCGTACATGGCCAAACACTTGAGG
ATGCTGCGTGCGCGGTCCACCTCCTCGATGCCATCGATGGTCTTCATGATGCTCACCACCACGTTACGGCGGCCCACGTTGTCCTGCAGTCGTGGTGAGT
ACATGGTCTTCGGTGCACCTGTGCGTTCGCAATGGCAACGATGGCGAGAGTCCATAGACGCGGTGCTGGAGGCGATAGTCGCAGCAGATCGGAGCTCTTC
GCATCCGCCACACAAGTCGGTGCTCCACGGAGCCGCCACGAACGCCTGCTCGCTGAAAATCACTTGGCCAGGCTGGAATGCGTGCTCACTGAACACCACC
TTGCCTTTGATGGCGTCCTGAGCCACGCGCACGCCGCATACATCGAAGGCGGGAGCTGATGCTGCCATCTCAAATGCGAATTCCTACCAGCCAATGGCTT
TATGATTGACTTGACGTTTGTATGGAATTTGCCAGTCGAGCGAGGATGGGGACATGGAGCTGTGTACGTGCGTCACTTGCATTTTCTAACGCTCTATTTA
TTAAAGGGGACATCCTGCCTGCTCCAAGGCGCGTCCGCAAGCTCCATGTTGCTACCTCTGTACTTCCTGCAGCTTCGCTTGCCGGCCTGGCTGCTTGCTT
GGTGGTGTCTTGTGGTAGCTGAGGGATCGTGTCCTCAGCAGATCGCCCACACATTTGAATAAACAACATGCACAGTGTCTCGTCCGCGAGCCACCCGAAG