Description :
From Genome Similarity Track
Location :
contig_3:25517- 26719
Transcript NameFunction/comments
g809.t1hypothetical protein

Sequence
1202 bases(100 bases per row)
CTGAGTCTCGTCATCGCCAACGTCTCCGTCCTCAGACGCGCTGGTTGACGAGCTTCCGTACGTCGTCGTCGATGCCGGAGTAGGCGACGGCGTCGTTTTT
GTAGACGCCGGTGTGGGCGTAGGGGTCGTCGTCTTTGTAGCTGCCGGCGTGGGGGTCGGCGTCTCGGTCGTGTTGGTCGCCGCGGGGGTGGGCGACGGCG
TCTTGGTCTTGGTCGCCGCCGGGGTGGGCGACGGTGTTGTAGCCGCTGGGGTTGGGGCCGGCGTTGTAGCTGCTGGCGTCGGCGTGGGGGTCGGAGCTGT
GGTTGTAGCTGCAGGAGTGACTTCGGGCGTCGTGGGGGCGGGCGTAGGTTTGTCTCCGCAGTCGTAGAGGTCACGCAGCTCGGTGGTCTGCACGAACCAG
CTCTCATCGTAGTCCTCATTGCCGTCGAAGGAGCCCGAGCCGTCCAGGTCCACGGTGTCCTCACCGTCGTAGTCCCACGTCGCGCACTTGTTCTCCTCGT
GGACGTCGCTGCAGCCAATCGTGGGGAGGACGCAGCCCCACGTGTCGCTGGTCACGAGTTGGCAAACGGCGTCTTCAGGGGCAACGCAGCTACCGCCCTT
GTACGACGGCAGGTACGAGTGGCAGTCGGCCACGGCCACGTCGCCTGCTGTGGGGCAGCTGAAGCCCACGGGCGACGACCCGGAGCCAGCGCAGAGCGTG
GACGCGTCCACCGACAGCTCGTACGTAGCGTCGCGGCACACGCTCACCTCGACGGCGGCGCTGGAAGACGCGCTGAGCGCCAGCGCTAGAAGCAGCGCGG
GCAGCATGTTTGTGTGGGAGTTAGTGTGGGGGAAATGTACCGGCCAGTTTCAGCGGCGGTAGCAATGCGGGTCTCAAGCGAAAAGCAAGAATGAGCCATG
GGATAGTCGGACCGCTCCTTGAGTTTTCGGGTATGTGGCGACAGGTGTCCACTTTGATCACTGCGGGCCGCGGATTCGCTGAAATGCCGAGAAGAAAGTA
TCTGATTGGCCAACAAAATTTGAGCGCAGGTGGCGAGTGGTTGGCGAGACGCATTTTTTGCCACATGGCCGAAGCGATTCAGAGCGGCCGATAATACATT
GCGTCTTGGTGGCACCGTTGAATGATGCAGCTAGGATCTCCACTGCCGCCGCCCTCGACAGCATCGGACACCGAGCCTAGCCTAGCGAAACCATGTTCGT
TC