Description :
From Genome Similarity Track
Location :
scaffold_22:25515- 27022
Transcript NameFunction/comments
g1175.t1 hypothetical protein PHYSODRAFT_249642

Sequence
1507 bases(100 bases per row)
TGTGGACGTAGTACGGCTCGTCCTGGTACTCTACGTCGCAGTACGGGAACGCGGTGTCGTCTTCCGACGGCGTGAAGAGCTGCTTACCAGCGTGGATCAT
GACGTAGCAGCCCACCAAGCCACACACCAGCATCACCAGCATCGAAACTGCCTTGTCCAGAACCGACATCTTCTTCCAGAAGACCCGCAGGTAAATCAGC
ACTGGCATGATCATACAGTTGACTGTGTGGGCAGTCGAACCCGTGAAGTCCTCGAGATCCAAGAATTTGTTCTGTGCAGCCACGGAGACGATGACCATTA
GGACAATGATCGTGATACGGAGTGTGATGTACCGGAACGTGTTCTTGGCCCCCTTGTACGGCTCACGAAGCTGCTCCTCGGTGATTTCTTCGTAGTGCTC
GTGTCCGTCCTTCTCTACAAGACTTGGTAGCTCCTGCGGGGTAGTGGCTTGCACGTACGACTGCTTCTCCAGATCTTCATCCAAGTTCTGGGCTTCCGGG
GCGTTGAAGCGCACAATTGGAGCTGTTTTGTGCATTCCCAACACCAACCGCTCGGCCATGTAGAACGCCGGCATCATCATGGTCGAGAAGGCGATGGAAA
TGTGCACCTGCATGAATAAATACGCCATCACGACAGCGCTGCGGTTGGGCGTGAAGCCCAGAGGAGCTTCACCCAACGGGTTGGACGTGTCCACGATGGA
ATACAAGATGTTCCCGGAGATCTGGCAGCCACCCGCAGTGTAACCGGCCAGAGCGATGGCGAAGAAGAACGCCGAGATAATCAGCATCGTGATCATCACA
ACGCGCGGCATCCGTTGAGGCTGCGAGTGTTCGCGTTGGAGATCGGGAATGACGATCGAGGCACCGTAAGCCAGCGCGAGGTTACCGAAACACGTTAAGA
TCTGGTGCAACGACGCGTCCGGCTTCGGGATCGACGGATGACCACGCATGTTGTACTGGAGGATCGACACGGCGATCACGTCGGCGATGGCAGTGCCCAT
ACACCCAGCGAACGCCATTCCAGCACTCTCCTTGAGCGTCGGGATGAGGCACACGGGGATAACCATGAGAGCCATGAAGATAATCCAAAAAGTTTGGCTG
AACGAGTCGGGGAACAGCACGTCGAGTAGTGTACTACCCAAGATCAAGAAGGCGCAGGGAACCAACACACAGACGCCCATTTGAGACACCACAGTGAAGA
AGCGGCCCCATTTTCCAAGAGCCCATTCACCGAGGTCACCGTACGTCCGGACGGACGATGGAGCAGCCAGCATGGCCTTGGATAGCTTCACTGCGGCGTA
AGTGTTGGCGAAGATCATGACAGCAAGAGCGATCGTGGCGTAGAGCGGTCCCGCACGCGCATAGTTGGACGGCATAGCGAGAGAACCGATACCGAGGACG
CAGCAGAAGAGGTTGAACGACGCCTTAGCGTCGTCCATCGTGACGAAAGCCATGAGGATTGAGGTGTACGCTTGGAATTGAAGAGTGAGTGAGCTCTAGC
GGCGTGG