Description :
From Genome Similarity Track
Location :
contig_57:255143- 256670
Transcript NameFunction/comments
g8928.t1hypothetical protein

Sequence
1527 bases(100 bases per row)
CTTCATCACTTCCAATTTGGCTGCCTCCAGCTCAAGCCTCTGATCAACAGCGCGCTCCAATCCTTTGCCGTCCCTGACAACCATGGCTAAGGGCCCTTTC
TTCACCGCGGAGGACGCCAAGTCGGCCTTCAACCTCTTCTGCTGTATCTACGGCGTTGGTACTCTTGGTATGCCCGGCAACTTCTCGCGCGCCGGCCCTT
TCCTCGCTGTTGTCGCCATGGCCTTCATGGCCTTCGCCAACATCTACGCGTCCATGACCATGTCCAAGGTCATGCTGCTCGCGCCCAAGTCCGTCAAGAC
GTTTGGAGACCTCGGTCAGTGGTGCATGGGCCGATTGGTCGCTGGCTGTGTATCGTCTCGCAAATGGGCTCGTGCCTTCTCCTCCCGTGCGTCTTCCTGG
TCCTCGGCGGTTCGCTGCTGGACGGCCTCTTCCCGGGAGCCTTCAGCCAGACGACGTGGATCATCCTCATGGCGCTCACGGTGCTGCCTGTTTGCTTGGT
GCCCACCCTCAAGGAAGGAGCTGGCGCCGCCTTCGCCGGATGCCTGGGAACGATCATTGCCGACATCATCGGCGTGGCTGTAGTCATACACGGACTCAGT
GGCCACCCGAGCGTGCCCGACACCTGACCTTTCGTTCGAGCAGGTCGCTGGCTGCTTCGGCAACCTGTCGCTCGCCTACGGGGCTGGTATCGTGATCCCG
GACATCCAGCGCCAGCACAGCGACCCCAAGCGCATGCCGCGCGTCGTGGGCGTCACCGTCGGCATCATCTGATCCTGTTCCTGGTGCTAGCCAGCACCGC
GTACTCGGCCGTGGGATGCCAGATTTCGGGCAACCTGCTCTTCACTATCTACCCGGACGCGGACACCGGCCTCACCAACCTGGGCTTTGCGCCCAACTGG
GGAACCATCGTGCTAGCCTACCTCTTCATGCAGCTGCACATCACGATCGCCTTCGCGGTGATCATCAACCCGGCGTTCTACATCGCGGAGCGTCTGTTCC
TGGGCATGCACAAGGCGGAGCAGGGGACCTGGAGAACGCCACCAGCTACCTGCAAACAACTACTCCGGCTGACCCAGCCGTGGTCCGTAACTCCAAGATG
TCGTACGTGTCGGTGGCCGACGCTGAGAACGTGCACAAGGACGATTCCGAGAAAGAAGCGATGGAGTACCGCGGTGCGAACGCCATCAAGTACGTCGTGC
TGCGGTTCATCCTCGTGGTGCTGCTTGTCATCATTTCGATTGTGCTGAAGGACGACTTCACGTCCCTGGCAGACTTCGTCGGCGCCTCGTGCATCACGGT
GAACTGCATTTTGCTGCCTATCGTCTTCTACCTCAAGATGTCGTGGGAGAAGGTTGCGATGTGGGAGAAGGTCTCGGGAAGCATCGTGGTGGTGATCTGC
TTTGTGCTGGGCTGCTACGTGACTTACACGACGGGAAGGAGCTTTTGCTCCGTCAGACGACGAGGCGGAGTTCCCGTACTGCGCCGGAGTTCGAGAACAC
GGTGTACTACAACGTCAGCGCGGCCAA