Description :
From Genome Similarity Track
Location :
contig_3:25511- 26713
Transcript NameFunction/comments
g722.t1hypothetical protein

Sequence
1202 bases(100 bases per row)
CCAACGTCTCCGTCCTCAGACGCGCTGGTTGACGAGCTTCCGTACGTCGTCGTCGATGCCGGAGTAGGCGACGGCGTCGTTTTTGTAGACGCCGGTGTGG
GCGTAGGGGTCGTCGTCTTTGTAGCTGCCGGCGTGGGGGTCGGCGTCTCGGTCGTGTTGGTCGCCGCGGGGGTGGGCGACGGCGTCTTGGTCTTGGTCGC
CGCCGGGTGGGCGACGGTGTTGTAGCCGCTGGGGTTGGGGCCGGCGTTGTAGCTGCTGGCGTCGGCGTGGGGGTCGGAGCTGTGGTTGTAGCTGCAGGAG
TGACTTCGGGCGTCGTGGGGGCGGGCGTAGGTTTGTCTCCGCAGTCGTAGAGGTCACGCAGCTCGGTGGTCTGCACGAACCAGCTCTCATCGTAGTCCTC
ATTGCCGTCGAAGGATCCCGAGCCGTCCAGGTCCACGGTGTCCTCACCGTCGTAGTCCCACGTCGCGCACTTGTTCTCCTCGGGGACGTCGCTGCAGCCA
ATCGTGGGGAGGACGCAGCCCCACGTGTCGCTGGTCACGAGTTGGCAAACGGCGTCTTCAGGGCAACGCAGCTACCGCCCTTGTACGACGGCAGGTACGA
GTGGCAGTCGGCCACGGCCACGTCGCCTGCTGTGGGGCAGCTGAAGCCCACGGGCGACGACCCGGAGCCAGCGCAGAGCGTGGACGCGTCCACCGACAGC
TCGTACGTAGCGTCGCGGCACACGCTCACCTCGACGGCGGCGCTGGAAGACGAGCTGAGCGCCAGCGCTAGAAGCAGCGCGGGCAGCATGTTTGTGTGGG
AGTTAGTGTGGGGGAAATGTACCGGCCAGTTTCAGCGGCGGTAGCAATGCGGGTCTCAAGCGAAAAGCAAGAATGAGCCATGGGATAGTCGGACCGCTCC
TTGAGTTTTCGGGTATGTGGCGACAGGTGTCCACTGTGATCACTGCGGGCCGCGGATTCGCTGAAATGCCGAGAAGAAAGTATCTGATTGGCCAACAAAA
TTTGAGCGCAGGTGGCGAGTGGTTGGCGAGACGCATTTTTTGCCACATGGCCGAAGCGATTCAGAGCGGCCGATAATACATTGCGTCTTGGTGGCACCGT
TGAATGATGCAGCTAGGATCTCCACTGCCGCCGCCCTCGACAGCATCGGACACCGAGCCTAGCCTAGCGAAACCATGTTCGTTCGCGAATTGCGATCGTC
CA