Description :
From Genome Similarity Track
Location :
Scaffold_19:255051- 259423
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007648Similar to nek3: Probable serine/threonine-protein kinase nek3 (Dictyostelium discoideum)
Pytul_DAOMBR144PYU1_G007647Similar to RAS1: Ras-like protein 1 (Physarum polycephalum)

Sequence
4372 bases(100 bases per row)
GTTGCATTTTGTACGAGATGATCATGCTCAAGCGGCCATTCGAGGCGTCGACGCTGCCTGAGATCTTCACGAAGATCTGCAAGGGTGATTATCCGCCAAT
TCTGCCTTCTTTCTCGCGCGAATTGCGATTGCTCGTTCAGCTCATGCTGCAGCAGGACTCGTCCAAGCGTCCTTCGATCGAAGACATTTGCCGATTCCCA
TTTGTGCAAGCTCCCATCCAAGCGTTCCTTTCGCAGCACGTGTCGGAGTTCCAAGAAGCGCTGGAGCTGGAGGCGAAGCTCCACCAGCCATCGCTGTACA
GCATGGGTGTTCGCAATACGCCGATTTCGCCTGTGTCCCCATCGATACGCCGTCGTAACCCGAATGAGGCTCCGTTCACGTCTAGCGAACAGTCGAACAA
CAGCGATGTGGAGAAAGCGTCACCAGTGTCATCTCGCAGTGATACCTCGAGCAATGCTGGTATGAACTACGGTCCACCGACGACGCAAGAGAAGGGCAAG
ATTCGTACTTCTGCGATCGCTGCTGCGGCTGTTGGACTGGCGATTGATTCGGCGCCTGCGCTGCACCACCAGAGTAGTCTCGACTTTGTGCAGATCAACG
GTGATATTCCGGAAAGTCTTGAAGATTCACTGGCAGATGAGCTTCGATCTAAGGTCGAGATCGCGGATGTGCGTGTTGGTATGTTTACAACCTACACCGC
GTGCATTTCGGGTCGCAACTTGGCGCAGGCACTGAAGAAGCACTTTGCCGAGGCAGAGAATGAAGCGCACATGATTCTGAACGAGTTGCTGAAGAAGAAG
GTGCTTAACCTGGTGTTTGCTGAGGACATGTCTCGGCCAGATGTGTCTCGTGCCGACACGTATCTCCGGTTTCAAGTCGATGAGATGTTCGGTCCTCTGA
ATGCGAAGTATATCTGCAACGATACGATTGCACCGGGGGCGATGGAGATTTGCCTTCGCGTTCGCGAACTGGTAGCGGAGTTGCACACGGCAGAGTCGTT
CCCTCGTGGCATCTCTTCTGGGTTCAAGAAACCAAATCCGTTTCCAGTCACCCAAGAAATCGAAGACTATGATTCTCCGTTGTGCTGTAAGTACCGTCGG
TTCTTAAAGTTGGTGTCGAAGTTGCAGAAAATCGATGTGGGTTCGGTGCCTAAGCACGAGCGTCAAGCCTTCTTCATCAATATTTATAACACAATGGTGT
TGCACGGCTTGATCGAGTTTGGCGTGCCGCAGAACTCTGGCCAGTACAAGGCTTTCGAGAAAGATGTGAACTACTTGATCGGCGGAATGGAGTTTACTCT
GGGAGATATCAAGCACGGCATCCTGCGTTGCAACCGAAAACCGCCAGCCAACTACTGGGAGCGTCAACTGCAGGCTCAGGACCCAAAGTTGCAGTTCCGT
CTTCACATCCGTGACCCTCGATCGCTGCTGGTGCTGATCGATTGCTCAGAGGCCATTCCAACGGCGGAACAAGTGCCAGTGCTGAAGCCAGGGCGAACAG
ATACCGATCTGGAAGAGCAAGTGGAGAAGTTTTGCGCTCGCCATATCGAGATCAACGACCGCACAAGCGAGATCCTGCTGCCTCGAGTGTTCCGCATTTT
CCGTGACGATTTTGGCTCCTCGGAAGCAGAAATGGTGTCGTGGTTGTCGCAGTACATGGAGAACGCGCCGACGCATCTGCTCAACTACCGCGTTCGTTAC
ATGAGTGGAATCTCGTCTTGAGCAGGTTGGTGTGCCATGATTGAAACGGCAGAGGTGGCAGGCGTCATACTGAGAGAAGATTCTAGTGATGAGCACAAAC
AAAAACTCGGGGTTGATGACAGAAAGAGGCTCCGAGTGAGTAGGAAGTGCAAATGTATATATTGAGCTCTTTATACTTTTGTTTATGAATTGAAATAACT
TGAATTTTGCTTCACAGTGTCGAGCACGCGATACGCAAAGGAACAGATGGATGGCGAGACAAAAATGACGCTGTGGTGTCGTGTTACTTTGTGTGTGTGT
TTTTTTTGTGCTTTTTGTCAAATGCAAGTGCAAGGGGAACTAATTTTCTACTAAGGGATCAAACAAAATGAGATAAAAAAAGGCTAATACCTCTCTCGCC
ATGCTACTTTTCGTCAACACTGGCGGAAGAGGACGGCAGCATTTTTCAAAAAGTAGATGGAGAGGAGGGAGGGAACGGGTGGGAGATCAATGATGGCTGG
CAACAGGTTTATGGAGATTACGATGGAGAATGGGATCGCTAGTGACAGGCTGGAGGAAGGAGCTGGCTCCTGGCATTGGCGCAGGAGATGCGGTACGGAG
CCCTCTGGCCCCAGCCATCCACTAGTGCGGGACGCGCAAAAACAACAGCTCGAGCCGCCTACAGGATGGTGCAGAGGTGCTTCTTCTTCGGCTCCTTCTC
CTTCACGGCTACCGGTCGCTCTTGTCGCACGGGACGCTCGGCTTTCCGGATTTCGCGCACCACTTGGTAGAAACAGTCTTCATTGTTTATCTGCGCACGT
AAACACACACAAGTGTCAATAAATGGCGCAAAACAGCCAACAAAAGCATGGACTCTGGTGCATATGGACGCACTCTTTCTTTGGCGGACGTCTCCATGAA
CGCACAGCCCCATCGGCGCGCAAGCTGCTCACCCTCCGACTTGGACACCTGACGCTGGCTTTCCAGATCGCACTTGTTGCCCACCAGCACACTACAAATT
TGCAGCCAAAATTCAGCAACGAAAAGCGTGGAAAGAGTGAGGGCGTTATGAAAAAAGTGCGTTTACGTACATTGGTACGCTGTCGACGTCCTTGGCGCGC
AGAATCTTGTCCTTGAAGGCGGCAATGTCGTCAAACGTACTGCGGCTCGTCACGCTGTACACGAGCAGAAAGCCCTTGCCTTCGCGCATCCACTATTGTG
CAATTTTATACCATAAAAAGAATATGCACATATAGCGTCAGCAACTCCATTGTATGCACTACGACAGCATATCCAACCCACGATGCATACACAATAAATA
AGGTACCTGGTCTTGCATGGAGGTGTACTCCTCCTGGCCGGCCGTATCGAGAATATCGAGCAGCGCCGACTGGTTGTCGATCACCGTTTGCTTACGGTAG
CTGTCCTCTATTCCATTATACAAACCATATCACACATATATACATATGCACCCAGCGTTAGCCATATTCAGTAAATATTCACCACCATGCGCTTATGGAA
TAGAGAAGAAAAGCAACGCAAGAAACATTTCCACAAAGCGCACCGATCGTGGGGTCATAGTCTTCCAGAAAGTTGTCCGTGACGAGACGGATCGTCAATG
CGGATTTACCAACACCACCGCTTCCCAACACCACCTGCAGACCCACATATGCAAAAAGCGCATATGCAAAACATGTTGGCCACGAGGTCAGCAAACACAT
TACGCAATCAGCAGTCGCTGATGCCACCTCCACAACAACAAGCCGCCTTCGATCTGTAGCTGCCAAAGTTGTTATTGCTGAACATGCAGATGCTACACAC
CAGCTTGTATTCTTTGTTGTCGGTCATGCTGCTCAGCTTCTTTTCTTTGCGTGTCGACGTGCAGCAACTACGTGGCGAGGCGAGACGCGCTGCTTTCTTT
CTATTGCGCGGTGTGTGCGGCGTGCGTGAGGTTGTGTTGGCGTGCGTGCTCGCAAGTCGCAACCGCGGTCGACAAGGAGAGGAGGAAGGGAGGGGAGCAA
AGAGGGGAGGGGGAGACAGTCGTCTTCTCTTCCCTCGACGCGAATTTATTTGTTAAATTTCACATGCGGGTAGGGTAGAGGATGGCAACAAGCCAATCAT
GCGGCGCGAGGGATCGGTAAACTACTGATTGGAGAAATGGCGCATCAGACAGGAAAAGGACGGAACAGAAGAGAGCGAAAAAGAACAAATGACGCCGTTT
GCTAATGTCGCCGCCATGCACGAAGGCGGAACAAGACGGAGAAATTCATCGAGAAAACAGCACACATATGTCGTTGTTTTTGTTGATGGAGGAATGCTGA
GGGTTTGATTCACTGTTCAGAGCATACAACTGGAGGGTACAATCAAGAAACAGGTTCGTTTATGTGTAATTTGTTTCCTGAACAACTGATAAATGCTGAG
GAAAGAGAGAAGATAAAGAGAGTAGGTTTAGGGTAAGCGGACGTGCACCAAATCAAAGTGTATGTGTGTGGGCTTTCATCCGGATAAAAGAAGACGAAGT
TGCTGCTCAATTCTGCAACATGTAGCTACCCACAATTTAACGCTTTGATTAAATATGCTTCGATTCCTTCCCCAACCTGTTCATAGCTGATACATAGATA
GATATGTACATTTACTACCTCTTTATAGTAAATGATATGTTACTAGGGACTTGACATGCATTACTACAGGGT