Description :
From Genome Similarity Track
Location :
Scaffold_133:255- 1670
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014981Protein of unknown function

Sequence
1415 bases(100 bases per row)
TGAGGTCATTCGATTGCGGATGGCCGTATGGATCAGAGTGAGTTCACTGAACAGCCGCTTACATGTGGCTGTGTTGACAGCGATGGAGAGAACAGTGAGC
GCGAGACGAGGTAACTTGCAAGACGGTCGATCTTGTTGCATCTGCTTCCAGAACCCTGCCACTGGATCGCTGAACTCGTCGGATGTTGTGTACGTGTACC
TGCCCGTCAACCACATACTTACACTATCGCGAAGGTGGCCGAAGTCGGGGCCGATAAAACGACGGTAGTAGTAGACTGCGAAATGTGAGATGCGGCTGGG
AGAGAGATGGAGGTGATCGGGAGCTGTCTTGCCTTGTCTACGTAGCGTGGGTGCAGAAAGTAACCCAGCATGAAGAGCGGTTGCTCGCATTTGCGCCATC
GTTGGTCGACTAGCGGCAAGAGAGCCTCCCGATGCTCCGAGTTCGCTGAGAATTTGCAATATATATTGCGGTACGAAGCCACAACGTCCGCGACCGTGTT
CTGGTCTCGCTGGAGGCAGTACGAAGCCGCAGATAATGGCCGAATGGTGCTCTCTGCTTCAGCAAGATCCTTCCAGAACTGAGCTTCCTTGAGTACGAGC
AGAGGTGCCGGAAACTTCGTCACGCCACTGTATTCACAGCATAGGATTTCAAGCGCTTTTCGGACTCGCAACAAAGAGGCAAAGCATGCCTGCATGGAAT
TCCACCGCGTCTCGCATAGCGCATAGAGAGCAAGCCGCTTGTTGTATCTTCTCTCCATGATATCACGCAGCTGCTTTAGCCAGGTAGACGACGCCGCGTT
CAACGCATTGACGATATCAGCTGCACGGCACGCAACGTGGCGGAATGTAGTCTTCAATACAGCTTTGACGAGGTTGTTTATGTCGTGCGCAAAGCAGTGC
AGGAAGGCGATGTTTGGCCAGCGTAGCGCCAGAATTCGACGTGCTCGTCCACATTGCCCAGCATCATCCGTGACGACAGCACCGACATCCCATTGCTCTT
CTCGTGCCTGACATAAGATAGTGTCGAGTTCTTGGGCAATCGCGACGCCATCATGACGGGTACCAATGGGCTTCAGTGCGTATGCCATTACCGACCCGAA
CAGCGACAGCTGCGACCCGAGCAGATGATCCTTTGAGATATTTCCACACGTCAGCAAGCAAGTTGACGCGGCCACCTGAGTCCGTGAACTCTGTCTTCAA
CTTGCTGTGGGCTTGCAGCTCGCAGCGCTGCGCTTGTTGGGTAAGGATGCGGCCACCCAGCACCTTCCGTGACGGCGAGCACTGTCGAAGTCCGGGGTAC
AAGTAGTCGTAAAGTGCCTTGGTTTCTTCACATTCGATGAAGGCATCTGGAAGGCGATGCTGTGCTGAAACGCGGCAAGGAATCGCTCGAAATCGGCAAT
GGCTTGTTGCTCCAT