Description :
From Genome Similarity Track
Location :
Scaffold_3039:255- 1557
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_3039-snap-gene-0.1Sodium/glucose cotransporter

Sequence
1302 bases(100 bases per row)
GTGTTTGCGCCGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGTGCATCATGTATGTGCTGACTAAGATGAGTGCGAGTGTCTATGGCGGCGCCGTTGTTATGAAGGCTACGCTCGGCTGGA
ACTTGTACTTTGGCGCGGGCATGTGCATCTTACTCAGTGCGATCTACACTGTCGCGGGTGGCCTCCGTGCCGTCATGTACACCGATTTGTTCCAAATGTG
CGTGTTTGTGATCGGCGGCATCGTCGTCATGGGGGTCTCGGTGCACCGCGTCGGCGGCTTCTCGGGTATCCAGGACCAACTCGAGTTCCAGGGCAAGTCG
GACTTCTGGCACTTGTTCAAGCCCACCTCAGACGCGGACTACCCGTGGACAGGCATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCAGCGTGTGCTGTCTGCCAAGGACACGGCGCACGCTAAGGGTGGCGCATCG
TTCGCGAGTATGCTCAAGATTCTTCCCCCGTTCATCATCGTCATTCCAGGTATCGTCGCCACGATCTTGTACGACATGACTGTCCCTGAGAACAAGACCG
ATGCCGCGTACCCAGTGCTGTTGACCAATTTAATGCCGCATGGTGTCGTCGGTCTCATGGTCGCGAGTATCATCACGGCCATGATGTCGAGTCTTGGCTC
CGTATTTGCGGCTGGCTCGTCGGTGATCACGAACGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTCGTGTTCGCGATTCTCAGTTTCTGCTGGATCCCGATTCTCAGCAACGGTGACGGTCTGTACAAGCAGATCGTCGAGATTCAGTCTTA
CTTGACACCTCCAATCGGTATCGTGCTCATCCTCGGCGTGTTCTGGAAGCGTGCCAACTACCAAGGTGCGCTCACGGCGCTTCTCTCTGGCGGATGCCTC
GGTCTCGTGCGGCTGATCTTTGTGACCATTGAGAAAGAGTCCAAGCGCGGCGAGTACCCCGAAGTTATCAACCAGTTCTTCTACATGAACTTCCAGCACT
TTGCAATCCTGCTCTGGGTCACATCCATGGTCATCTGCGTCGTCGTCAGTCTTCTCACGCCGCCGCCGTCCGCGGAGTCACAGAAGTACATGGCCGACGT
CG