Description :
From Genome Similarity Track
Location :
Scaffold_3:2549686- 2551099
Transcript NameFunction/comments
Phyin_T30-4PITG_02544Putative uncharacterized protein

Sequence
1413 bases(100 bases per row)
TGCCAGCCGATATATCTACCGTTTCAGCCACTAGGTGCGTGCTCCGAAGTGGTTGTACACGTGTCGGTGCTGGTACACGTGGCGATCGCTGTGGTGACGA
TGTTCTCGATGCAACCACCTTCCTTGCGCGCTTCTTTGGGGGTGTTCTCACCACCGTTTGGGGGGGGAGGCGCCTTTGCTGGCGGTTTAGTGTGAGACTT
GGTAGGTTGCTTGGCGGGAGACTGGCCGGGAGACGGAGCGGGTGACTTGGCCGGAGCCTTAGCAGGAGTGCTGGCTGAGCATTCGGCTGGCGATGTATTC
GGCTGGCGATGTGTCGGATTGGACAGCTGGCAGGCGAGCGGGTGATGCTGGGACTGAAGCTTCAGCAGCAACGGTAGCGTCGTCATACAGAACTACATCA
CAGTAAGTCTCTTCAACATAAGTATAATACGCATTTTAGGACGTACCATCTTCAAGCAAATGCTTCCATTCTTCATCGGGACCCTCATAATAGTCGACAA
GGTGGGCTGCGTGTGGGTGTTTCTCCCAGCCTGCAGGTGTAAAGTTGCGATTCTCAGTTGCAAGCCCTTTTGGGCGCTCACACCTCCATCCAAGTTTCTT
GAGTTTGGTCCATATTTTTCCCCAGGTAAGCGACTTGATCCGCTTGCGTTTTGCCACCCAGCTTTGGCTACTGCTGTCCGTCCGTCCGATTCGCAAATGG
CGCGAAACCTTGGACACGTGCGAAATCACTGAATCTGAAAATCTCGAAAGGCACTCGTTATTCAGCCAGACTGGGTAGCAAGAGACAGTACAATTACACC
AGAATACACCCGATTAGCATGCCCGAATATGCCAGACTCAGGAAGAGCAGGAGACGGCATCAGCTGATGCGTCTTCGGGAGTATACGTATAACCGGAAGC
TCGATGTCTGTCGGTTTCGAAAATGAAATCTGCAAGACATTCAGCAAACTGCGCTGGGGATATCTAACTCTCAAGACAAAGTGCAGGGTGAATAACTCGG
AGGTAGTCATGCCATTGACACACTCAAACAAAAGACCAAATCATTGAAAACTTGCTCAGCTAAATGCACATGCAGAGATACCGATAGCGTAAATACTGCA
ACTCCTTCCTACTTAGCGCACGCATAGTAGTAGCACCGGCAAGTATCTCGAATGCCAACAGCATGTACATGGTACAATTGTAGCTATCGAGCTGTACCCC
AAGATCACTTTCGTATATTCGGGCTCGGTACTTTCTTGGGGCAAAGTCTGATGGCATCGTCACCAATTTGTCAGCAAGGGGCGAACCTTCACTCCGTAGC
TGGAATTCATCGGGTCGTAGACTCATTCGTATTTACATGTCAGGTCAGTCATGACGGAGCACCAGTGATTCTTGCCGCAGATGATCGGAATCAAAATCTT
CTCGCCCGTAACA