Description :
From Genome Similarity Track
Location :
Scaffold_24:254960- 260965
Transcript NameFunction/comments
Physo_133095reverse transcriptase
Physo_133096reverse transcriptase

Sequence
6005 bases(100 bases per row)
GGGGTATTTAGGTTTTCTTGATTCTTCTTCCAGATCGTCACGTCCAGTTTTCAAAAAAATAAAAATCATGCAAGTCTTGTGCAGTAATCGTCTTCGTCTG
CGTTTCTGGGCTGCATTGCCCCAGGTACAGGTTACCATCTTCCGCAGTAGTTATTTTCGTCTACCCTCCTGGGCTGCGTTGCCCCAGGCGTAGTTCATCA
TCTTTGAGTCGTCGCGAGCGAGCTCTAATCTTCGTCCGCGACCTGTACCATCTGAAGGCGTTGCTCGCTTCGCTTGCGCCTCAGGTAGTCGTAGAGAAGA
CCCCCACAGGAGAGCTGGGTGACTGGTTCCCACGTGGGCTCGTCCTGATCTGCCCACTTGATCTTGAATTCACGCACTGAGCGTCCCGTTCTTGTTGACA
TGGGCATCCGATCATCCAGAATCTCCAACACTTCGTTCTCACCGGCCAGACTATCAGGTTCCCAGCTGTCTTCGGGGAGTAATTCCTCATTGAAGTCCAG
ACGTGAGTCTTCGGTGATGTCAGGCGCCAGTCGAGTCTTCGGGCGGTCTTTGAATTCACTCACTGGCTTCAACCGCGAGACATGGACTACCGGGTAAAAC
CGATAGCCGCTCCGGTTCGACAACTCGAGCTCGTAGGCGTACTCTTCGACCTTCTTCTTGATCCGGAACGGGCCGTGCCAGCGGTGGGCCAGCTTCTTGG
TCAGCCCCGGCTTGACACGTTCCATGTACAGCCGTACGCGACTACCCGGCTCGAATAGAGACATCGGCGCGTTGCTTGAGGGGTCTGAGTCCGCGTCCTG
ATTGGTTGGCATCGCTGTCGACGACTTGTTCCTGCCAGTCGTCGGGATGGTTGCTCTCTCCTTCCGGCTCAGTGCTTCGTTATGTTCGCGTGCTCGGCGG
GCTTTTTCAGTCGCTTGGCAATCCTTGGCCATCTCGAGTGCAATCTGGTGTTGTCGGTTGACGTCCCGGTGCCACGCCAGCGCGTCGGATTGTCTGCTAC
TGCCCCTGCGGAGCGAGGACGACATCGCTTTCAACGTCGACTGAGCGTCCCATCCATGGACGAGGATGAATGGAGTTTCCTTCCGTGTCCTGTCTTGTGA
GTTGTTGATCGCGAAGACCAACCGTTCCACGATCTCGTCCCAGTCCTGCTGAAGCGGGTCTTCGGCGTACACTCTCACGGATTGAATCACCGTCTTCACC
GACCTCTCTTGCTGCCCGTTGGCTTGAGGCCGATAACTCAGCGTAGCCCGCGACCTTGACTGCATCATTTCGGCAAAGGCCTGGAACACCTCGCTCATAA
AGCGAGGATCCCGGTCGTGTCTAACCAACGAAGGTGCTCCGAATCGTCGGTATATACACTCTTCGAAAGCTTGGGCTACCTTGAGCGCTGTCGTGTCCGA
CATTGCCTTGGCGATCACAAATCCCGTGAACGCACATTGGAACAGGAGGAGGGCAGTGTTGCCTCTCCGAGTCATCGGGAGCGGTATTACGAAGTCCATG
GACACAATCTGGAGTGGTCGCTCTGCCAACACGTTGCCGGGAGAATACCCTCGCAACTGTGGTCGGCTTTTGCTGGTGCTGCAGTCCGGGCACGACTTCA
CATGCTTCTCGACGTCTGTGTAGAGGCCGAACCAATAGTAATCCCGCTTGACTCGCTGGTAGGTCCGCACTACCCCTTGGTGCCCGCCTTCTAGCGAGTC
ATGGCAGTTCTGCAACACTTCTTGAATCATCGTGGTGGGTACCACAAGACGCAGGTTGATCTCCTCTTGCTCTCCAGACGTGTCTCGACGACTCGAATTC
ATACTCCGTCGTCGGACAGAACGAACTTGTCCGCAATTTTCCAGGCATCTCGTGCAGCCCTGTACCCGAGCTTCTCGACCTCGCCTCGGAGGACTGTTTT
CAGGTTTGTCCACCGTAGTTCCTCGTCCTGAGCGGCTGCTATGCGCCGTCGCCTCTCCGCTTGGACTTCGACGGGGTCAATGTCTTCTGCGTTTGGCGCT
GCGGGCGGTGCTTGAGCTGCTTTCGGTGGTCGTTCATCAGTGTGCTCTTTGTCGGTTTGAGTCATCGGCTTGGGTGGCGTCTCGTTCGTACTGTCGTCCG
CAAATCGGACTCGCTTCGTCTTCGATCTAGCCTGTGAACGAGTCATCGCCATGATCCTGAAAGGTTCTTTGCGCACGAAATCAGCGAATGTCCTGGGTTT
GGTGACCTCGTATCCGTCCGCAATTTGAATAGAGTCTCCAGGAACATGGTTTTGCACTGTTGCTTCATCTGGCGTCGACTCATAGATCACTTCCTGGATA
CGGTTCAGTTCGCAGAGCTCTGCCTTCCGAGTTTCACTCAGGACCACCTTCGACGTCTTGGATTCAAGTGTTTCCGACGCCAATGAGTCTGCGGCCGCAT
TGAATTCTCGAACCACGTGCAGGTACTTGACTGACCGCAGTCGTGCCGTGATTTCCTTGTGGCGACTCAGCTGAGTCATCAGCGACTCCTTCCGGCATGC
GATCACCCCTAGGGATTGCTGGATCGCGAGCCTCGAGTCCCCGACGATGACCAAGTCTTCGGCGCCATGGTCCAAAGCTGCAAGCACTCCGTTGGTCATG
CCAGTGTACTCGGCGAGATTAACAGTCGTCTTCTCGAGGCAAGCGCTCGCCGCAATCACTATTGTCCATTCTGGTAGGCGCCACACGATCCACGAACAAC
TGCCATATCCACCATACTTCTCGGTCTTCGCGGAGCCGTCAAAGGAGACCACAAACCCCGTGTGAGTCTTCGGGAGACGTGGGTACAGGAAGTTTGGGTC
CATACGAGTCGTCGGCGAGCCTTTCGTTGGTGGAGCAACCAGGTCCAGCGAGTCATCGAGGTCCACAAAGTTGGTTACCGTCGACTGGAGCAGTTGTGAA
AATACGCAGTCCTTCTCCTTTACGCGCTGGACGATCAAGTGCCACGGGGAAAGCAACACGGCGAATTGCACCGCTCTCCCGAAGAGTGATTTGGACTTGG
TGATCCATTCCAACGTAGAGAACCGCGTGTACACGCGGATGGTCCGTCCCGCTAGCTGCGTATAGCAGGTCTTCAGGAGCTGGAGTAGAGCCAACACCTC
CTTTTCTGCAGGATGGTAATTCATTTCTGCGGCCTTCAAGACGCGACCACAGAAGCGCACGGGGTGCAGTTTGTCGTCGTGCATCTGGAGCAATGTCGAG
CTGAGTGCCCATTCGTTCGCGTAAAGCATCACGTGCACGTCCTTCTTCTTATCGAAGTACCGACGGATCGGCGCCGCCGCCACCTTCTCCTGAAGTGCTT
GGAAGCTGCGGCGGGCTACAGCGAGGCCACCCCCGGGCGTGAAGTCGTCGTCCTTGAGCTGGTACAGCGCGGCTCCATAGACTGCAAAGTCTAGGATAAA
CCGGCTGTAGTAATTCAGCGCTCCGAGGAAGGACTGCATCCCTTTTCTGTCCGAGGGAACGACAGCTTCGTGATTGCGTCCAGTTCCTTGTGGTCTGCGC
GCATCCCATCTCGCGAGATCTCGTGTGACAGGAAATCGACGCGTCCTTGCACGAATATGCTCTTGGTGAAGCTGACGCTGATCCGGCACTCCTCAAATCG
GCTCAAGAGCCGATCCAGCGTGGCAAGACAGTCTTCGAAGCTCTCGCCTCCGGAGCATATGTCATCCACAAACGATCGGCGATCAAACACCGGAACCAGT
GACGAGTCGTCGGGCTCGATGGTCGCAAACATGTCCGCCTCCGGGCTGTTGATCAGCAGCAAGACAGGATCTAGTGCCTGCGAGTCATCGTGGGCGGCTG
CAAACTTCGTGCGGGGCGCTGCGGAAGGGTTCTGCAGGTATCCCGACGACTCGAGTCGTCGGAGACGTGCTGATTCGGCTTCGGCAGCTCCCATCCGTCC
CACAAAGGCCTTCCAACCTCCCTTCGGCTGGGCATGACCCCACAACGCGTTGTCGATCATGCGCTGGTAGATCATCGGCGCGTTCTTGAGGCCGAAAGGC
ATGCGAAGCCACTCGAAGTGTCCCAGCGGGCAGACGAAGGCCGAGATCTTGCGCGCTCGTAGCGTCATCATGATGGCCCAGAATCCACTCGCAGCGTCGA
GTGAGCAGAACCAGAGGTATGCTTCTAGGTCGGTCAACAAGACATCGACGAGTGGCATGGCGTATTCCATGATCGCTGTGATGGCATTGACCAGCTTGTA
GTCGATGCACAGTCGAATGTCGATCCCGTTCTTTTTCAGGACGATGACGATCGGCGATGCCCACGGGCTGTCAGAGAAAGACACGAGCCCAGCCTTGAGC
AGCCCCCTCAGCAGCACATACAGCTTCTTGGGATGCCGTAGTGGTATCCGTCGGGCTCGTTGCTTGATCGGCGTGTGCCCTTGCACGTCTATGTCACAGA
CCACCCCATATGCTGGTGGTGGTAACGCATTACCGCTTGCGATCATAATTGGCTCATGGTTCTTGAGCACCTTGATTAGATCGTCCTGTCGTGTCGCCGA
CAACTCAGGATTCCGCACATTGTCTGCGTCGTAGTCCAGAGTGGTCGTAGCAGCTTCGGACAAGTCAGGAAGGAACGCCAGCTCGTGCGCGTAGTCTTCC
AACCCGATACCAGCCGCGAGATGCTCGAACGAGTCAGCGGCGTCGTCATTCGCGGTCTCTGTACCTTCTGTGCTCAAGACCCGCAAGACACACATGAACG
TCTGCTCGAGTCGTGTCAAACCGGCCTCGATATCCGAGTTCGAGCAGGATTGAGTCGTCGGGACTTCATCCTCAGTACTCTTTGACTCCGTAGGTTCGTC
CAAGCCGGTTCCCGACGACTCATCTCCCCCAGCAGGGCGCTCAGACGTCTCCAAGGCAGCTGCTTCCACTCGAGTATTGAGGGTCACCCCTGTCGAGTCG
TCGACGGCTGCAACTATCCGTTGCGCAACTTCTTCTGGTGCGGATTCTGGATCATTGCCCACTGGCAAGCCGTCAGAATCTTCACCTCCATCACTGTCGG
ACGACTCCGAGCTGTGCTCGTCTTGAGAGTCTTCGGTAGGCCGTCGGAGCAGCCCTTTTGGAGTGGGATACTCGGGTCGATCCACTGCCGACGGCTGGGC
AGCTAACCATTGAGCGTAAAACTCAACTTCCCACTTGAGCAGCGTCTTATCGCGGGCGGCCTCGTAGGCAAGGACTTGCCATTCCCTATACTTGTCAGAG
TCGAGCCGCACATATCCCTCAGACTTCGGCAACGACCCGATTGGTACCCACACCACGAAGGTTGTGTGAGCTGGACAGATCGTGAGCCGGTTGTCAAGGT
TAGTCAGTCGGATCGGCTGCGGATGTCCCTTGTGGAACCGCTTCACCGTAGGGATGAGCTTGTCGGTCTGTCGGATCCACGGCACGTGAGTCGTCGGGGA
CGGACGTTTCCGTTGCATTCGGAACTCTTTCCATTCTCGGCCGGGAATCTGCAGCACGTCGACCGGGCCCCCGTTGACGTGGACCCCTTCGGCCTCGTCG
ACCATGTTCTGCGTCTTGATCAGCGGGATCATCACTTCGTCCGGGAGCTTGGCCGCCGCGTTGAAGAGGTCCAACCGGATCCCAGCCGGGATCATGAAGT
CGGTGCCTAGCACCACGTCGACGCCTGCGTTGTGGTCGATGATCCACATCTCAAAAACGTAAACACGCTCCCATCCGAGCGTAATCTTCACAGACGCCCT
CCGAGTCGTCGTCGCCTTGCACTTGGTGATACCCTGGACTTCCATACACCGACCATGGTCTGGAATGTCCTTGATTCTCAGCCGGTTGGCGTACTTCTCG
GAAATAACACTGACGTTCGCTCCAGTGTCCAGCAGGATCCTCGTTCGCGAGTCGTTGACCGCTCCATTCACCAGCGTCCTCATACGTACTCGTCGGTCGA
ATTTCTGCGCCGACCAGCATCCCATACGCTCTCCGGGTAGAAGGCGTACCTCCACGTCGAGTCGTCGGCGCGATGTTTCCTGCACTGCACTCGTCACCCA
GTCTT