Description :
From Genome Similarity Track
Location :
Scaffold_10:254905- 256877
Transcript NameFunction/comments
Hyaar_Emoy2801958hypothetical protein
Hyaar_Emoy2801959hypothetical protein

Sequence
1972 bases(100 bases per row)
TCTGCGCGCTGAAACCTCCCGTAGGTGCGGTTCCTGCGGTTGCCACCTGTGGTCGCCTAAGGTCGTCGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCTGCGGTTGCCACCTGTGGTCGCCTAAGGTCGTCGAATCCCTTACGGTCTTGCTCGTGTTCGCCCGATCGATCGCGGT
ACGATTCAACTGATTCCATTTCGATATCTTGGATGTATCGCTCTTGGAAATTCGTTGTCCGTTCTTGGACGACCAGGTGACTTCCTACTTGTCCTTCGCG
ATTGCGAATGAACTTGTCTATAGCTGCCTTGAAATACGTATGTAGTTGACTTGGTTCAACCGTGTTTGCATTCATTGAGGCCGGTGCTTTAGTTGACCGC
ACCCCGCTGTTAGTCGAGTCGAGCCTGTATCTCATCAGCGCTTCCCCCGTCGGCCCCAGCGACATCCGCTGCATTCCAAATGATTCGTCTGAGTCCAAAT
CTGATTATGCCGATGCACAGCGCGATGAACCTGTATATTCTTCTTTCACGATGCGGTCGACCGGCTCGATCACTTGGACCAGGTGTTCCTCCTTCGGGAT
ATGGCCGATCTGCGGAACCCTTCTGTCCGTATTTTTCTCTTTCTGATCTGTTATCCGCAGAATCGTGAGACCCCGTTAGTGGAATTAGCTTCTCGAATAG
TAGCTGCCCTGACTTGATCACCCGATCTTGATTGCATTCTAAGAGTGTTTTTAAATCGAACGCTCCGGCCGTGAATCCGGTGTCTCGTAGCAACTGGATG
AGACGACGCATTGCCTTCAGCTGATTCGAGGTCACTTTGGTGGTGATCCCGGGCTATGGATCGACCTGATCAGCTTAGGCTTCATCACCTTTAGAACTGG
GTCTTCTGCGAGAAGTTTCTTCAGTTGTTGCCAAAGAAATTCCCAGGTGATCCGTATCAGCTGCTAACCTTCTGATTCCGTGTCTTGCCTTCCGTCTTGA
TAGCTTGCTTGTTTCGATATGGCTCTTCCGTCTTCATCTTTGAACGGGACAGCTTAGGCGTGTGTTTCTTCGCGTTTGATTGGGCGTAGTTTTGGATGAA
AATCTTCCAGTTTTGACTGAAGGGTTTTCATCCGGCGGACCATGTTTTGTAGCATGATCTGCGAGGGTCCTTAAAGGGACCTCAAGGGGGTTAGAGGTTT
TTCTTCCAGATCATCTTGGTGATATTCCTCTTTAACATTCTTTTCATAATAGCCCCTTCCAGAACTCTGACGATCTTGGTATCTTTTATCTTCGCGCGTC
TGCAGCGATCCATCTTCCGCTGGCTCTTCAGTCCCAGGTTCAGTATTGACTTTAACATCTTCATCACGGGACTCACGGTAAAATCCCAAGTCACTAGAAG
ATCCGGGCACGCGTACCATTGTGGTGGAGTAGGGTTCGCTCATTTATGAAACAATCCCGACTTTCCCCTGGTGCCCAGATGACCGACTAACAGAGGGGGT
ACTCCGATTCCGCTTGCACTTGTTCCTTCCTCACCTTGTGTAACCGTCGTTAGGGCGGCTGCACTCTTCTAG