Description :
From Genome Similarity Track
Location :
Scaffold_303:2549- 7311
Transcript NameFunction/comments
Physo_125608reverse transcriptase

Sequence
4762 bases(100 bases per row)
CCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGC
TGGTTGGTAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAACAGATGCTGTTCTCAGCCAATAGGAATCCTAAGTCTCTATGGACCATCCGTCGTGG
TGGTCGTAAATGTATGTAGCCTTTGGTGTGTTTACACCAAGGTCGAGAAAGTCTTTCGAACCTCTAACAGACGTCGTGTCTGTTAGAGTTACAAGTGACT
GTAGCCACTTGTGCGTGTAACCCTGTTACACCATCCCCCCCTCAAGGTTAGACTCGCCGAGTCACGGCACGTCAATCAGGAAATTGACCATTCGTCAATT
CTTCACGTTGGGAGAAAGAAAACTCGAGCTCATTCCGCAATGAGCTCGCCGCAGAAGAAGACCGCCGCCGCAACAGAGGGTAACCTCTCTGTTGCTCAGT
ACCATGAGCGCCAGCAGGCAAAGCGCGATGCGCTCGCTGCAAAGGCCGCGTCGGGGACAACCCAGTCGGAGATTGTCCTCGAAGGTTCCTCTGTAGTCAA
CGACGTGGAGATGGAAGATCTTCTAGCAAGCGCAGGGAGCCTATCGACATCGATAGTCTCGACCCGCATGCTGGGTCGAGACGCCCTCGTGAAGGAGACG
ACTCGGACGCTTCGAGCTCGAAGCATTCGCGCGGTGAGAGCGACACTCCGCTCTCTGCTGCTGGGGCTTTAAGCTCCCCGCGTGAGGTGGCGCCTTCAAG
CTTTCCGCGCGCTGCTCAGGCAGCGCGCGATCCGTGGATGCCGTCTGCGTCAGAGATCGCAGACCGTGTGGGCAACACTGTACCTCCAAACGAAATCCCG
CTGTACGTATGCAGCGGGATCCACGATGATGCTGTGGCGGAGGAGCAGCACTTTGATCCGTTAACGAATCAAAGGCGCGATTACTATATCGGACTCTTTC
ACAGCTCCGATACTTCTCCAGCAAGAAGACCTCTTCTCGCAGCAAAGTGCCTGAGTGGCAGGCACTTTGTCAAAGTTGGAATGCTTTTGTTAAGAACTTC
AACAAGATGCCGGCTGCTTACCGTGAGCGGGTTAAGCACGCCCGTGAACGCTTCGAGACATTCTCGACGCGCGGGAGGTTGGAGCAGCTCCACAGATCTT
CTGTGGACGCTGGTATTCCATGCGCTGTGCCTGAAGGCCAACAGTGCACGTTGTGTCTTCCGGGTGCGGCGCGCTTGAGCGACCGCGACCTAAACGGGTA
CACGACGATTCGTGTACCTGCGAGTCTCAAGGATCTCCGTGCCAAGTTCTTGGCACGTGAGGAACGCGACGATCGTGGGACCTCGGGCGCTGTAGGTGAC
CACAGCGCTCGCACTACCTTCGCGTCGGCAGTGCGTGGTGAGCTTCGTACACCTTCACCATTTCCGGAACGTCCTGCAGCAGGACGTCCCGTGGCTCCCA
TGTATCTTGGTGGGGCGGAAACCCTCTCCAACAAATACGATAACGAACCGGCTGCCGGTTCGTTTTCGGGATACTATGGTTCACAATACGCTCAACAATC
CAGCGTGTTGAGCCGCGGGCGTCGCGGATCGGAGGCGGCGGTGGTGGGAACACGCTCCGGGTATGGCCAACCTGGGGTTGACCTTGCCCGACGCTCGAGG
AGCGGGTCGCTGCTGTGGAGCAGCTTCAGAGCCGTGAATTCGCCGCTCTGAAGCAGGAGATGGCGACCCTGAGAGCTCAAGTTGCTCAGGCCTCGCAGAC
CGCGTCGGACATCTCTGTCGACGTGGGAGGTCGCGTCGTGCGCTTGGCACAGCGCGTTCACGCGTTGGAGCAGAGGTTCGCTCCCGCTGGGGCTTCCGCT
TCGGGCCAGCCGAGCTAGGTGACTCGTGCTGCCGGTATGGTTTCAGCCGCCCGACGTAAAAGGTCGGATGGAGGCGCATGCTAGATGGAATATCTAGCGT
GTAGGCGTTGCCATGCCGTGCCAACACCGTGAACGGCCCGATGAAGCGCGGAGCGAGCTTGCTCGCCCCGAAGTCGGAAACTGCATGTTTAGGCAGGTTT
TGAGTTGCTAACAAAACCAATGAACCCTTCTTGAATTCATTAGTGTTGCCCCTACCAACATTGTCTGCGTTCAGCTTCTGTCGGCCGACAGAAGCTGCAA
TAGCGTCTTGGACAAACCGAATGATGGCTTGTCTGCGCTGCACGAAGTTGATTGCGTCCGAGATGAACTCGTTCAGCTCGTTTCTAGCAGTAGGCCCGGC
CTCTGCGTTCGTCTTCGCGGTGTCTGTGCCCTGCACAGGCCCGTTCTTCTTCTTCTTCTTCTTGCTCTTGTCGGCGTCTGTGCCCTGCACAGACGCGTGC
TTCTTCTTCTTCTTGCGCGTAGTCGCGGCTGACACTGTGCAAGTGTCAGCGGCATTCTGTGGCTGCTGCGTTGCAGTCGTAGATCCTCCCCCACTTAGGG
AAGGAGCCACCATCCCGAGTAGACTCGGGAGGCGTGGGGGCCTGATGGCATTCACGTAGAACGGTGTATGCCCGGTCGAGGCATGCACCGAGTTGTTGAT
GGCGAACTCCGCCATCGGCAGGCACTCGCTCCAGTGTTGGAACGAGTGAGCGTAGCTTTTATGCACGTCTACGAGCACGCGGTTCACGCGCTCGGTCTGC
CCGTCCGCCTGCGGATGGTCCGCACTCGACATCGAAAGTTGACTCCCAAGAAGTGTAAACACTTCTTGCCAAAGGTGTGCAGTGAAGCGCGGGTCTCGAT
CCGACACAATGTCGATCGGCATGCCATGGTGTTTGAACACCATGTCAACGAACAGACGCGCCGTCTGTTTCGCAGTCACTTCAGCGGGTACCGCAGCAAG
ATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAACGCCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAGGACATGGACTGC
CAACACTCCCGTGGAGTTGGTAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCACACGTTGACAAACCTCGCAAGCACGGACGTACATACGCA
CCCATTTATACTGGTGGGCCCAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATACTCATA
CATGATCCTGAGTCGCAGGTCATGGTCATTGGGAACGACAACGCGGTCCGCGTTGTCGTCGACTGCACTGTAGAGTAATAACCCGTCGTGCACCCGGTAA
CGGTGTGCACGAGCACGAAGATGCTTCGGCAGCTTCTGACGAGCTTGGTCAGAAGGCGCTGAGCCGTAGGCCAGCATGAGCTTCGCGTCCGCGTCGTGCG
CGTACGCGACCTCCACGTCGTCCAACAGTGACGACGTCGGGGTGCTCGATCGCATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGG
TCGACGCGAGAGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGATGTTATACTCTGCGAAGAATGAGAGCCATCTCGCCATCCGT
TGCGAGATGTGCGGCGACTTCACAGCCGTCCGCAACGACGCGTGACCCGTATAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGA
GTGCGTACTTCATGGTAACGAGCTCCTTGTCATGTACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGATCACGACC
CTCGTGATCGTGCTGCATCAGCGCACATCCGATTGCGAAGTCGGATGCGTCACACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGC
GCCTCAGTCAAGACCCGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTA
TCATGCCCGCGTAGTCCTTCACGTACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCGGCCACTCATTGAT
CACTCTGACCTTCTCAGGGTCAGGGCGGACACCGTTCTTCCCAACGAGGCACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCACTTCTTCAGGTTC
GCATAGAGCTTGTGCTTGCGCATGAGCGCAAGCAGCTTCCGGAGATGCACCTTGTGCATCTCAACATCGCTCATCCCGTCCGCAGCCCGGCTGTGGACGA
ACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTTGCAGGGGCGTTCTTCAGACCCTGCGG
CATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACAGCCAAGAGAGGGATATCGCTCTCACGCATTAGGATCTGATAGAACCCATCGCGCAGA
TCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATAACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGT
TATACGCATGAACGATGCGCCAGCCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTTGTCCAGCTTTGCG
ACGACTTTCGAAGAAGTCGTCGATCGCTTTGACCTGCTCTCGCGGCAGAGACCCCCATTACG