Description :
From Genome Similarity Track
Location :
Scaffold_306:2549- 4650
Sequence
84 bases(100 bases per row)
GACGATGGAACCATCGAGACGTGTCCGCGCTGCCTCGTAGGTTTCTGGGGTGTCCGCTGTGAGAACCGGTGCACACCGAGCAGC