Description :
From Genome Similarity Track
Location :
Scaffold_1:2548841- 2555714
Transcript NameFunction/comments
Phyin_T30-4PITG_00495Fat-free family protein
Phyin_T30-4PITG_004963'5'-cyclic nucleotide phosphodiesterase%2C putative

Sequence
6873 bases(100 bases per row)
GCAATGGAGGACCACGGTATGAACCGCATGCAGGAGCTGCTGAGCAGCTACTACGGGCTGCAGGACCAGGAGAGCAGGCAGGAACAACTGCGCAACATCG
ACTCACCTGGTTTCGATCCCAAGATCTACGTCAAGGTAGGCCCCGATCGTCCTAATAAGAAAAAGTAGCCATCTTACGCGTCTGTCTGTAGGAGTTGCTG
ACGACCCGCGGGCTTAACGATCTTCTGGCAACGGACGACAAGCTGATCCGTGAGATCAAAGATCTGGACACCAACATGCAGATGCTCGTGTACGAGAACT
ACAACAAGTTTATCAGCGCCACAGACACGATCCGCAAGATGAAGGTTAGAGTGCAGCTAATAGGGCGAAATGTTGCTCAATATTTATGATATTGACGCTG
GATTGACGCTACAGAATAACGTGGCGAGTATGGAGGACGAGGTGGGCCGTGTGGTCAAGAGTATGGACACTATCACAGCCAAGAGCGAGAGTATCAACGT
GGCTCTGGCACCGCATCGCTCCAAAGTGGAGAAGCTCATCGGCGTGCGGAGATTGCTCAAGAGGTTCGAGTTCATTTTTGAACTGCCTCAACGACTAAGC
ACGTACGTCTGGGTGAGGGAGGATATTTGTTGCTGCTATTACTGATTAAGTTGCAGTGCTGTGAAGCAGAAGGAGTACGCTAATGCTACCAAGTATTACT
TGCTGGCACGTCGGATTCTGGGAAGATATGAGCATATTTCGTCCTTCAAAGTACGTTTGCTGTGATGTATTTGTCTGATAATTTCTCACGGATCTTGCTT
ATGTCAGGCGATTCAAATGGAAGCAGAGAAAATTATCCAGCAACTCGAACGTCTACTCAAGAAGCGGATGCTGGATACCACTCTCGAGTCCAAGGAGGTA
AATACTGCGTACTTCTGTTACTTGTGTCCATTGAGTTAAATTCATTTGCTGGCTTAGCTCTGCGACACGGTAGTGCTCCTGCACCAACTAGATGCATGCA
ACGACGAGATCCGAGACCAGTTTTTGGAGTGGCATCAAGCGTACTTTGAGCGAGCGGTAGCCGTGTCTAAGGTACCTATCCGGTTGATGACACACCATGC
GCTTCGTACGTCTAAAAAATGACCTTAATCTTCTTTGTAGACTCAAGGCACGACCAGCTCGGTGCTTGGCTTCCTACAAAGATTCAACGCAGATGTTTTG
ACGAAAATGGGTCGAGTATTCTCAGTGTACAAGACCCACTTCTTGCCTGAAGTGGTCACGCGCGAGAAAATGTCAACGTCGCGAAAATCTTCTGATGCGG
TTCGAGACGATTTGTTCCTCAGCTTCGTGAAAGAATTGTTTGCGCTGTATTCAGGCGAGTGTATTGTCCAGTTCCGACGCCCCCACACAAACTTTGTACG
TATATTGCTACCATACCAGCACTGAACGCTGCTAATTTGTACCGTGTATGCATCGCAGGGACCAACGGACGAAGTTATTGACGTGCTGCAGGACGAGAAT
TTCTCGTCAGCTGTCGTGGAGAGCGAGTACTTTGTGTTTATGCGCGTGATGAAGTTCTTTGTCTCACAAGTCGAGGAAGTCGATAGAACTATTCCGATGT
GTGGACTGGCCGCGAGCGCCACTGAGATTGTGGAGAACTGTGTGCGTTTCCAGATCGAAGGTGTCTTCAGAAAGCTACGTGAGGATACTGCGGAGTTGTT
TATCACGTCTCACGAGGATGTCTCGGGGCTGGCACGAAGCTCACGTGATGGCGGACAGAGCGTTCAGCCGCTAGCACAGCACTCTGCGAGGGAGTTTACA
GACATGATGCAGAAGGTGCTGCAGCAGATGGAGCCGATGGTGCAAACAGGTTTCGCTATCCTCTCCGAGCTCAGTCGTCTCTTTTCTGACTTGGTCCAGG
TATGATTCGTGGTGCCCTCTTGCAGATGATAAACGAGTGATTGCTTACGTGTTTTTGAACTCATCTCGATGGTCCAGAGTCAATTTTACGATTTCCTCAA
GTGGTTTAACGCAGCGGTGCTCCAGTATGCGGAACCAAAGCGTGCGTTTGCGGATGGACCGCGAGGAACACGAGAAGAGCAAGACAGCGTAGCGCTTCCA
TCGCTGGAGTCAACTCCCCAGTTTTTGCTGTTTCTGGCTTGCCTGTGCCAAGAGTTGTCGACTGAAGGTATCGGCGAATGTGTGCGTGGGCTCATTGAGT
GTTTGCCAGCTCCTCTCTCTCCGTCAAGACACTCCGAGTCGATAGGAAGTCGTCGGATGAACCAGCAGGACGTAACGCACATGATCGAAGTGACTCGCGA
GTCCTCAGCAGAGCTCCTGCAGCATGTCGCTAAACATTATGGCAACCAGTTATGTGTAATTGTCCACAATGGCGTGGCTGCTACGTCGTGGGCTGACATG
GATGAGGAGCCAAGAAGTGTCCAGGAAATGATGGCTGCTGTCGTTGAAGCCACGTTCCGTTTCGGCAAAGAAGTCGCGTTGGCACTTGGCGATGAACAGA
ACATCTTTATCGGCCATAACAGTCGCACTGCGAGTCGTGACTTCCGTCGACGCGCTAGTGCTCTACGGTCTCGCAATGCTGGAGTTGCTAGTGCGACGTC
AGGCATGCAGCTAGACGTGGATCGTATCTTTGCTCGCAAAATCCAAATCTTTTCGTCGCAACAAGAGCTTACGGCGGATGCATTCGTCCACACAATGTTG
AAGATGTGCATCAAGGCCTTCAGTGAGTGGGTGAGGCTGCTGGAGCTGTCGAAGTTTGGATTGCAGCAAATCCAACTGGATGCTGAGTTCCTACGCAGCA
CTTTGCTGCACATTGTGGTGGCTGGTGAAGCTGAGGAAGAAGTGGAGAGTCTGCTGTCTGACCTTCTCTCGAACGCTCGTGCACGAGCGGTTGAAGACGT
GTTGATGGACCAGAGCAACGTTGTGGCCATTGTGAGTACCAAGAGCACTCAAGTGTTGTCACGTCGAGGCTGATTACGGATGGCTACAACATTGGAGGAA
TGCAGGGAGTTTTTATAATTTTTTTTTGTGTTACTACGTTTATTTGTTGGTGGTGCGTGGTTTAATGTTTTTGAGTTGTGGTATCAGTTTTGATCAAGTA
GACGTCTCGTGCTTGATACGCGCTCTACCAGCTTACGAGAGCTGGCTCCACGGACGCTCACTCTTGCCAATTCTTCGACTTCTGCCGCTTCTCGCTGGAG
TTTATCCAGTTCAGCTTTGTAGCGCTCCCGATTGGATTCTAACGAGTCTGCGTATACCTTCATGGCAGGACACAACGTGGCTAGTGGCAACCAGATGGGA
CGTAGCACGTAATTGATGAAGTTGAGCTGCACGGTGACTCGCGTCTCAGCGTGATGCAGATTGGCCATGAAGGATTCGACTGGGAAATGCAGTTCGGCTT
CGCTCTTCGCTTGTTGCTGATATTCGGAGAGGACACGCATGCCCCAGCGAGCTGCTTGAGTGTACGGCAGGGCTTGACTGGATAAATCTGCTGCGTGGAT
AAGGATTGTCATGAAGACAAAGCGATGTTTACTGCGTCCTCGCTTCGCTCCTTTGCCTCCGTTATTGTTGACAAGGAGATGACGTTTCGAGAGACTTTCC
AGCGCCTTGCACTTCTCAAAGTGCTTGGCCATGTCTGTCGCCAAGATGCAGTGGATGAGCAGGCGACGCACGTACACGAAACAAGCCCGCGTGGGCAATT
GACCGAAGAGATTTGCGCCTGGATGGCTCAAGATAATGAAGGCAACGCGACAGTGATGACGCTCCAGAACGGCGTCGTCGTTGTGTGTGAGTGCAAGTTG
ACTATGTGTCTTGACTTCGAAGTCGTTGGTGTTACCAGGATGATCCAAGTCATGACACAAGGCAGCGATGAGCATGGCAAAGATCTCCACTCGAGCGAAG
TACGAATGCGCTACACCGGAGCGACGAAGCAGACAATACGTCGCGTGTGTGACTTGGAAAGCGTGTTGCAGGTTGTGGTAAGCGTTCGGTCGGTAATGAG
ACGCCACATGTGAAAGAAACGTCGAGAAGGTGTCCTGTGCCACCTGGAAACGCTCCAATAAACCAAGCGAGTGAAAGAGGACTGACACTGCTGCGAAGAT
GTCTGCGTTGGAGAGATCCAGACAGCTAAAGTCCCAACGTGTCACGTCACCGACACCAATCACATGTCCATTCTCTCGGGGTGTTGAGATTCGTCGCTGA
GGGTTTCGCGGAGGGAACGGGATAGCAGCAAATGGTGTCGTGTGCTTGTCCTCGTCGTCTAGATCGCTCTCTTCTTCGTCGTAATCCCCGGCATTCGCAT
CATCCGTGTCTTCAACCTCATCGGGATCGTCAGCATAAGCGGCAGTTGCCATTTCCTCCAGAGCGTCGAGTTCGCTCGATTGACAGTATTTCTGCACGAT
TGATGAGACGATCTCGCCTTCATTCACGCCGTCCATTTGCTGCTCCTGCGATGGGTCAGCAGAGTCGAGCAGAGACTCACCAGGCGCGCTAAGGCCGCAG
TCCGACACTACTTTATAGTACGAGATATCCAGCGACAATCGACCGAGTGCGAACTGGATTTCTCGACAGTACTGTGTCATACATTCGGCGTCACTTGTAG
TGAAAGGCACACGATGTCTGGAATTTCGACGAGAAGCTTCGTCTTCTGTGGCGTTTGTAGCGCCATCGTCTTTCTTGTTGATGGCGATGACGACCGCCAC
GATCTTTGGGTTCGTGGGTGTGTGATCCTCAAATACGGGCATGCCAAGGACGCTTGTGGTACGGTATCCAGTCTTACGATCAAGACTAGGGTCGAAGTGT
GGATGAGTGTAAGCGTCTCGTGTGTTGACAGTCTTCCCTGTTGTAGCGATAAGCCCCGAGAGGCCTTTGGTAAGCGGCATCCGGACTCTTTCTTCGTCTT
CTTGAGTGATCCAGAGCTCTTTTTTCAACGGATCCACTAACAAGAAGCCGAAGCGGTCGCAATGAAGCAATTTTCTACCTTCTGCCATAACGACTCGCAC
AAATCTGGCGACTGAGGCTGCAGCACTGGTCTCATCTTCAGGTTCGTGACTGGAGTTGTTGTACGCTCGCTCCCCGTTGCTGCTCACGAAGTCAGCAAGT
TGCAATCGAGCCTCAGTCAAGCGCTGTGACATCAACACTGCGCGTAGGAGGTTGGACTTGTGCAGCGAGATCCCTGCGGCTTCTGCGGCGTAATTGAGAT
ACAACGCGTCGTCCGCTGTAAACTCGTCTCCGTCCACCTTGTTGGTGGCGCTCACGACTGCCAAGACTTGACCACTCGCATCTTTGACAGGCGCACAAAG
CACCTGCTTCGTCTTCAGTGATGCCCAGAACTCGTCGTACTTTGGGTCGAACGCTTGGTGTGTTGGAGCCGCATTGGTAAGTATAAGCTGTCCAGTGCGC
ATGACGACGCCGACGATACCGTTGTGTGCTTTCAAGAACCTCTCGTCATATCCAGTATGGGACTTTTCGGTGGCTTTGTCCTTCAGTTTGTGTCTGGTTT
TGGTGCCTGGAGATCCTGTAGTAAACATCTCGTCTTTACTATCAGTGACGAAGAGATAGAAGTCGTCGGTGCCTTCATCGCGCACGTAGAGTGCGATGTG
CTCTGCATGTAGCAGCTCATACGCTACTGCGATGATTTGGTGGAGTACGGCTGAAGCGCTGACCTCGGCTGCGATGTTGCGATTAAGTTTAAGAAGACAC
TCGATGCGACTCTGCATGGCTTGATGGGCTTTGGCCAGCGATAAGTTCCATAAGGCCGTCCCCGCAGAAACGCAGATGTAGTCGAAGTTCTCTTTGTCGC
GTGCATCAAAAGCTCCTTTTTGTTGCGCTTCCTGGTTACGACCAAGCCTTGATAGAGCTGTACGAGGAGTAGACGGATACCACTGAGACTCTGATGGAGT
AGCATGGCCTTCCTCGGGTAGTATCTTGCGAGTAATGACCTGGAAGACGCCGACTAATACTCCGTGGACGTTAAAAATGGGGGCACAAAGCAGAGCTTCT
GGCTCGAACTCAAGCACTTGCATCTGCTCTTCAAACACGTCGATGACCTCAGAGCCGCTGACGTCTGCGACCTCGAGAGGTGTTCCTGTCTTAGACAGTG
CGGCACTGGTTAGACGATGGAGTTGTTCATGACGAATACTTAAGTAACATTTACCAACACGACGCGACCAAACGTAGTGGCTGAGTCGACGAGAGCACTG
CCTTCCTCGATGAGATAGCGCTTACCGGGTAACTCCATTGGTGGGTTGGAGTACAGCTCTACACGATCTTTCTTTTCATTGAGGATACCCACCGTGTATT
TCTCTGCCTGGAGAACGTGCTGTGCTGCACGAAGCGCGTTGCTCACAACGTCCGGGGCGTCAGACGCTCGGGAGATCTCACGCATCGCATCCATAAGAGC
GCGGAGCTACGTCAAAGGATCGACATAGGCTGTAAATTTTATATTGCTACCGATATCAACACTCAAGACGTACGTTTTCCTCTCGATCTGCGAGCTGGTT
GAGTGTCTCGGCCTGCTCTTCGATGAGATTGTGCATGCTAGCGCTAAACATTTCGCTCTTTGGCCGTGGACGTCTAGGCGCAGACTTAAGCATGTCACCA
GGTCGATACGGTCGATTCTCCACGCGTGACCCACTGCAGCAGTCCAGTTGATGCTGTCGCTTGAGGAGCTTGAGCTCAAGCTCCTTCGCCTCCTCCTCGA
ACTGCTCCAGCTCCGCTGTCAGTCGGCGGTTCTCGTCTAGCGCTGTTCTAGCCCCGTGCATGGCTGTCTTAAGCTCTCGAACGGGCACCCGCACCAGCTT
CACCTCGTCATCCGACATGCTGCACGGAAATCGAATAACTGCTCGAGTCGATGTTGAAGTTTTCGCCCCGTCA