Description :
From Genome Similarity Track
Location :
Scaffold_508:2548- 9824
Transcript NameFunction/comments
Hyaar_Emoy2814245hypothetical protein

Sequence
7276 bases(100 bases per row)
GCAGGGCGACGACCTCCATATAGAGTAAATATACAACTGATCACTGTTCCAGATCAGCATGTGGTAATCCCAGTTGAAGGATTTACTGAAATGAAGATTG
GAGCAGGTTTCTTTAAATCCAAACTATGGGTAAGTTGTAGGACAAAAAGTGGGTGTCGACGGTTACTTCTGGCCCCGGTAGAAGGAAATCTAGTCAATAT
CGAGTACGAAGACGCCCCTTGCAGTGAAGAACAGCGATCGTTAGACATGCTACTGCGGTTATTATGATTGCAAAATGGCGATCCGACACGGGGTCGGTCG
GTTGAGGCAATCGGACAAGCAAAGGCGGTCAGACCGAGGGTGATTGCTGGGATGAGGGAGATCAGGAGCAAAAACCGTCAGATTAAGGTAGTAAAAGCGC
TACAACGCCCACGATCGAAGAAGATTCAGCGGAAAAACTTCGACGAAAACTACGGTATATCGCCATGACACGGATGACCTGTTCGCCGAAGACGTCGACC
AACATATGGCGATCTTGCCAGAAATAGTCGTTCCCACGGCAGATGTTGCTATCGAAGACATCCAGGTTAGAGATCCAGGTATACCACTGACAGATGATCA
ATAGAAGTTGATGCAACTGAAATAGAAGAATCGCCATTTACTCATAGGCAAGGGGAATGCCCTGCCTCCAGCTGCGCGTGGAGCGGGTATGCGATATTTA
TGTCGGAAGTGATAATCCGATCGCGCAAAGAGTACGACCAGTGGCAACCAAATATCGAGAGAAACTGGCGGATTTAATTAAGAGACTTCTGTCGGCCAAG
AACATCCAACCATCCATTTTACCTTGGGCTTCTCCTATCGTGGTGATCATCAAGAAAAAAGGGGAAGATATACGACTATGCATTGATTACAGGAAGATGA
ACCAGTTGACAAGATTGACGATATATTCCATACCAATGATTAGAAAATTGCTGCAAGACTTGGATAAAGCAATGTGGTATTGTTTTTTGGACATAGCGAA
AGGATTTTGGGTGGTGGAAATGACAGAACGATCAAGAGCTATATCCGCTTTCGTCACGCCTTCGGGTTTGTTTAAATGGTTACGGATGCCTTTTCGGTTG
AAGAACGCTTCCCAGATCTACCAGCGACTGATCGACAATTCATTATATGAGTATCTGAAAATCGGCCCAAAACCTTACTCGAGTACAACACCGTCGTCGA
CGCCAACAAATGTGTTCACTGACGGAGTGCCAGATACGGACCCAAGACCGTCGGTCCTAGGTAGAAGATCATATATTGACGACAGCTTGATATCTGCTAC
GTCATGGACTTCCTTTTACAGAAGGGTTGAACGACTGTTAGAGGTGTTTGATGAATGGAACTTATCGATCAGTGTGATCAAAAGCTTCTAGGGGCGTCGT
AACGTCGACTACCTAGGCCATCAAGTTTCGCTTGTAGAATTGGAAGCCCACTCTAAGGTTTTAGTATAAATTATGAATATACCCTTTCCTCCAACTCTAC
GATGGATGCATTCATTCTTGGGAAACATAAATTACTAGATTCGCTTCATTGAAGACTTTGCAACATATGCCTCTGTGCTCTATGATATGCGGGAAGCTGA
TTTCCATGAGATTTGCCGTGACTAGGACTTCCAGCTGTCTATATCAAAGAACGAACCCATTCGCGATTGCGATTCACGAGAAGGGTGCGAACGCATTCCT
GACTCAAATGCAGAGGGCGATCTGGACCAAAACATTGGGGCGATCCGAATTCCGGAAACAGAAGTCGATGGAATAAAAAGGTAATAGCTCTTACTCTGCT
AAAGGCTAAAATTGCTAAAACCCTAATCTTAAAACATTTCGACCCAGACCGATCGCCTGTGATTGTGGTATACGCCAGTAAGTGGGCTGTATCAGCTGCA
TTACTCCAGGAATACGACGGCATATTTTGGCCAGTCACCTTTTCTAGCCGCACGCCGAAGTCCAATGAAGTCAATCATATAATGGTCGAGAAAGAGGTCT
TAGCTCTCCTCCGAATATTAGACATTTGTTATACGATGTTAGTTTCACGAGAGACTATGGTATTTACGAGATATTCGACGTCGGCTTGACTATTGCAGTC
GTCTAGTCTCAACGGAAGAATATGGAGATAGGCAGGGCTACTATCAAACTGGACTTAGAGATCCGAAGATTTGAAAAAGGTGAAGACGAAATGCTGGGTA
TGCTGGCCGCGAGTGTGACACCCCGCAAGGACGTAGACGAAGTACCGATCGCGATTGCTCCAAGAAAACAGCCACGATAAACCATAGGCATGCCACCACT
TACGTTCGAAGCAGACAAAAACCTCCTGGAGGTTAGTTTCGATGGATCGGCTAGGGTAAAGAAGAAGGGCGGCGCCTACAGTGAGATAATGTGGAAGTTA
CCTGAGTCGATGATCGTGGGTGCTATTTCCGAGTTTGCAGAGAATTTGACACTAAATGAAGCGGAATACCGTGGACTATTGCCTGGCTTGGATTTACTTG
CTGATCAGACTAGGGGCGTGTGATCTTTTGTGGTGACACGAACTTGGTGATAAGGCAGATGCGGGGCGAGATTGGTTGTAAGGTACCATGTTTGCACTTG
CTGTGGCATAGGGCAATGGAGAAACACCGATCATGACCAAAGCATGAATTTCCTAATATAAACGGGGGTGGAAAAAGAGTGCTGATCGGCTAGCGAGCGA
AGCTCTACAGTAAGAGAAGGAGGGGTCATGGTATCAGACCAGGAACGAAACAATCTCATGATGCTTAATCGGTTGAGTAAGTTACTGATACCAAGACAAG
GCTTCCTCCCAGTCATGGTGGCTGCGATCACTCGGTCAACGACGCGAAGACGATGTTCCTTGACAGTTTTGCAAGAAGAAATCGTACAACAGGTCTGGAT
TGAGCGCATAAATCGTGCGCAAGATGAGGAGAGTTGGATATCTGACTTGAAGACGTATCTGATCGAGAATATAGACAGGCTGAATGCTAGAGAGGCAAAG
ATTTGCGCCCTAATCGTACCGGACTACGAAGTCGACCAAAGTGGCAATTATTTATCTGTCCTAGGGCAGCAGCAAAAAGCGAAGAATGTGGTGAGTCGGT
TCGTCTGGTAATTCGCGAGTTGTTGCAATGAGATGTCTCACATCATTACCCCACTAGTTTGGAGGGCGGGCACCAAGGCGTAGACCGCACATATCAACGG
ATTAGGACGAACTTCCATCGGCGGAGATTGTACCGGAGGTGCAGCGCAATGAACGCGAGTGTGTAGATTGTGAAACCGGCAAGGGTCGCCTGCATGATCG
AGGTGGGTCACCAGAAAACTTACAAGCGGCTTATCCATCTCAAGTTCTGGCCATGGATCACATCCCGTCTCTACCGCTATCGTTTAGAGGAAATGTAGAG
TTGTTGCTGTGGATCGATCTGTTCTCGGGCTACGTGATAGCAAAGGAGAGCTCGTCCCGGACTGCACAGAAGATCACAGAAAATTATGTAGAATGTGTAT
TTTGAAGATTCGGTGCGAGTGAAGCCATCCGCCATGACCGGGCGCCAGTTTTCATGTCCAATTTATTCCGAGCGTTTAAAAAATCGCGGGACAGAACCAA
CGGGCCTTATGGTGTATTGACCTCAAGCGAACGGAATCGCAGAGCGCATCGTACAAACTCTGACACGATCGATTAAAATGTACGTCACTGATGAAAATCA
GAGAGATTGGGACGAATATGCAAAGAGATTAACCTATGCGATCAAAACCACGCAAGATCTTGTTCGCGGAGAAACGCCGTTTTACTTGATCCATGGCTGG
GACTCGCGAACGACGTTAGAAGCAACCCTACCAGTAAGAAAAGCACTTCCGCAATCACGATCCCAGAAGCTGGAGGTATAGTATGCAGTGCCAATAGAGA
GAGATCGTGAATGAAGACAATGATTCAAGACAGGGCGAATCGTCATAACGAAGACCTCAATCTTATGGAGATAGATCAAGGGTCACAAGTATGGCTATAT
TTGGATCGCGTCATAGATGGGTACGCTCGAAAGCTAGATCATATGTGGCATGGACCATTTCGGGTAGTTTAAAAAAATACGGCGACCACACAGTGAGATT
AGCAGTCGCAGGCACACCTTATCAATTGTTCCCAGTGGTTCATATGTCCAAGCTGGAACTGGTGAAGACGTTTCTAAAGCAGCCCCAGAGTCGATTTAAC
GTAGGCAAGTCCGATCAAGTCGATTTTTGATGAAGCCTTACTATCAGAGGATAGTTGGGAAGGCGAATTAGAAGAGGACTTGCTTGAGGTAAGTAAATTG
TGGATTTGCGATCAGGCTGAAAAACGCGCTACAGGCGAGTATAACGTCAATTTTGGTACATTAGAAAGTTCATAGCGATCCGTCATGAGTGGATGAAGCA
GACTTGAATTGCGGCGCTTTACTACAGAAATTAGATCGCGACCGAGTAATCCGGAACCGATTTGAATTGATGCAATCACATGAAGAAGAGCCAGGGGCCT
AGACCAGATCAGGGTGGTCGGAGTATGTAAGTATGCAAGGGGGTTGTATTGTTGTAAGGTGGAAAAAATTGCACCAGGAGGAAGGGCTGTTTGTCAGTGT
GTGTGGCGATCGGGATACCAGGGCCCAAGGGCCTGATAAAAAAGAAGACATTCCAAAAAGTATCGACAACGTGGAGAAATGAAATTGAGACTTGTAAATG
TATTAAATTAGATGGACTATGGAAAGACGAACTTACCGGCTAGGCGAGGGATCGACATGCCTGAATGATCCGCGATCGAACCCAGTACTGATTGAGCCAC
GGCTCAGCAGAATTCGTCAACAGTTATGCGGAAGCCAAGTTGGGGATATTGGTTTTCCTAGTCCCCAACCCAGGATACCAAAACTGCTTCTTAGTCAAGC
GAGGTAGATACAAGAAAACCTGGTCCAACAGAATGTCCATGTCACATGGGCCTTCAATCTTCCCATGGAGTATGAATTGGAGAACTATTTTCCAGCGGGG
GCCAGTTAGTGATCGCCGCTGCTTCTTTTGGTCACAAGGTGAAGCCAATCCCGGATCGCGAACCCGATCTGCGGAGGAGTTCGGCAAAGTGTGAATCGAT
TCCTACAAGGTCTGGATATAGCGATTCTGAAAGGAGTGGTACATATCCAGCACTGCTTGAACCATCCAATGGGCTGGAAGCACATGGGCGAGATCCTTGT
CTTCAGAGATTTCCAAGATATATGGCGGTAAAGCGTGTCGATCTGTGCTGAGGAAAAATTAGGCTAGAGGACCACTCCGACATTGGAAGTTCTCGACACA
CTGGAAGAAGCCGAAAAGCAATAATACTTGGGTCTTGCAAGATGGCGATAGAAGAACCCCGAGTCCAGCTCCGACCCGCTGATCCAGCTCACCTGGATGG
CGGACCAAGATGAGACTTGAACGAAGGATTTTGGAATGCGACGGCGATACCCGGTTATCCACTGATAGCGGGTCACTTTGGTCTTGGCAAGAACATCATA
CTCGGCCGGGGGCAAAACGTATTGATAGGGGCTCGGGCTTCTACCGCGACACTGATCGCGCAATCCGAACTGCTGGAAGATTCACTAAACAAGTACACCC
TTAAAGTTTTGGTTTTGGGCGTGGGAGAGGTAGCGATCGGGGACGCGGGGGAACCCAGAGCGGGGCTGGGGGTGTCCACCACGATTAAATCCAGCGAAGT
GGAGGACGGAGGCAGTGGGCTACCAGGCTGGACCCTACGCCGAGAAAAAGAGCGTGATCAGGAGAGCGCAGCCAGAGTTTCGGACCCTGCATCTGACGAA
TCATCATCATCCGGGATAGACGCGGCCGACGTCTGGACTAGCTGTTTGTCCTTGCTCTTGCGACTACCAGACCCGAAAAAACAGACGTCTTAGACGTTGA
CTTTACTGGAGATCGTTTGGAAATGCGCGATGGACGAGGAGCATCTTTCTTGGGATTCTTACTTGGAGGAGGAGACGTGATGGGACCACCAGACACAGAC
GAAGCAGAATTTTTGGTGTCGGCTTGACTGACGATCGCGGGGAAACGCAGGGAGGGCGGGAAATACCTGTCTTGGGCTTCTTGATTAGATGGTACGCTTG
CTGCGGACATTCGGAGTTTCCGCTGAATCCTTCACACCTGATGACCCAGGCAGGGATGGAGCCACCACGACAAGACTGGGCGAAGGAGGCATGGTCAGGC
TAGAAGCAAAATTGTTGATACTAGCTCGAAGTGCATCACGATCGCGCAATACTCGATCGCGCTCGGCTTCCAGATCCGAGATCTGGGTCTGGAGCCGACC
CACTTGGTCGACCCAATCGGAAAGTAAGGAGCGTAACCGATCGCGATCGGTCTTCATATCTGCTAGATCGTCCTGATACTGATCGCGCGTCATCGTCAAA
ACCGCAAGCGCATTGTGCAGATTGCAAATCTTGTTCTTTTCCTGAGAGTACCCAGTCTTGTACTTGGCTTTCTTGGACTTGGTTTTTCGGAGTATTTCGG
TTTGTTGGGTGAGCTCAGCGTTCATTTGGGCATTCTCCTCATCCATGTGTTGCATTAGGGATGCTAACGCACGATCATGATGCTCCTGGACAGGATAAAG
CGATCGAGTCGTCTTCCGAAGCTTCGATTTCAAATCATCGGTCGGGTGTCCTGGCCTCGCCCCGCAAAGACTTCCTCTCGAAGAAAGGCGGCCTCCGCTA
ATGAATCTTCGAGATCGATACGAAGACGATAACATCGGACTTGAAAGAAAGTCACGAACGGAGAAGCTGACTCAGCAAGGAAACGGAGATCCTGGTCTAG
TTGATAACCTCGACGGGTATGTTCCCTCGTCGCTTGCTCCAGATCCCGATAACTCTCGACGAGGTCTTTCTGGGACGCTACCCGTTGATAAGGGTAGCGG
TAGTGTCGACCACAAATGCTTGATCAGCTATCGGTGGTGATTCGACTCGGGCGGTCAGTAACGAAATCCCTCCGATAGAACCGGAGTTCACGTTGCTTAT
CGCCATCAGACGTCGCGGGAGCAAAAACGGGAATACATTCACAGTGGCGTTACTCAAATTGGACGATGTAGTAGCAGACGTCGACGCGGGGGCGATCGAA
CCTTCAACTGTGGAGGTGCCACGAGCGACGGAAGGCGTAGCCGACGGCGATGGACCTTCAAACGCAGAGGTGATGGAAGCGACCGGGGGCGTAGCCGACG
GCGTCGGAATTTCCTTCACAGAGGAGCCACGAGCGACCGAATGCGTCGACGACGGTAACAGACCTTCAACCGTGGA