Description :
From Genome Similarity Track
Location :
Scaffold_374:2548- 5945
Transcript NameFunction/comments
Phymu_g9230hypothetical protein PHYSODRAFT_485275

Sequence
3397 bases(100 bases per row)
ctgctgcctccgcTGAGAGAGGAATATGACCAAATGCCCCCGCCACATCCCCCGTGGCCATCCGAGCCAAACCAGGGGAATCTCGCTCGACATTCAGTAT
CCGTTGAGCTAAGACAGCAGCTACGTCGTAGGTGACATCGATTGTTGGTTCATCTTGGGCCTGATCGTTCACCAAGGTACCCTTCGGACATGAGAGGTCG
TATATCACACGGGTGTCATGCGATAAGTCCGCTTCTCCTTTTGGTACTGCTCCGAATGGACTGCACGAGATGCCGTCAAGCTGTGGCAGCAGGCCGATGT
CCAAGATCAAATATCCATTGTCATCTTGACCTTTGCGAATGCTTTTGACCACCGCATTTCAAGCACGCGCGACTGATCCATGATTTTGCGGAGGTATCTT
TTGCTTAGAAAATTCGTTCCTCCAGGTTGGTTGAACTCCGTTCGCGGCTATGTTGCACCATCCTTTCTTGTATTGGTATGATTTCCAGCACGGGAGGTGA
TCCGGCACGCTTAAGGCTTTGTTCGGCCGGGGATCGCTCAGTGTTTTTCCCCGAACGTGGCGAATTAAGTCCGGTAGTCGGATTCTTGATCTCCGCAACA
ACTCACTGTAGACCGCTTGTTTCTCCCGATCGATCCGGTATACTTGCACTCCCTTTCATATAACCGAGGCCGGGCTCGTGGTCGGAAGTGATATCCCATA
GTGGTTCAAGAGCTTCGTTAGATTGGGGGTAGTGGCGCCCTGCGGCAGGGTCAATAGGCACTCTCGTGCTCGCAAGGACATCGCGTATTGCCGTAGCTGG
GCCTCCGTGTACGAAAGCAAACGCTGTGCTAGCGTGAGTTGAGTCACTGGTGCCTTCCGACGCGGCCCAGACTTGTCCAGGACGCCAGAATTTAATCGCG
TCCCAACACAGTACCTGTCTGCAACCGTCTTGCAGCGGCTTATCATCGCCACCAACGTGGCTCCCAGCCTTGTAAGAGGTTACAATCGGTCTGCACTCGT
CTTACAGCGGCTTGACAACGCCTTGAGTGTGGTGTTTGACCTCATCAAGGCAAACTACCTGCCTGCAAGTCAATGGTAGCGGCTGATCAACGCCGAACAC
GGGGCGTGGGGTCACTTCGGGGCCGTCAATATTTCTGCTATCCGTTAGCGTTTCACTTAGCGGTTGTGGATATCGTCGTTTGTCCTCTTTGCAAGCACCT
TTGTGGCTCTCTAGAAGGTTATGACCAGTCGAACAAACCGCCGATGTGCCAGGTGGAGGCTTCTGCTCAGGCCTGAAACTAGACGCCTTCTCATCTGTTC
CATGGCCTCCTCACGTTTTGGCGGCCCCGTCATCCTTGGTTGTACTGGTAGAGTGCAATCCCCCGTAAGCCTTAGCGATGAATGCCTTCACTAGGTTAGG
CAGCTTCCCCAAAACAAAGTGTCCGCGATAGTCGAAAACACAGGTGTCTCATTCTCCAAGACAACATTCTACCGACAGAAACTTCATGCAGAGCTTTTCT
CTTTCCGGATAAGTTGAGCAGCCACTACGCCCGGCGGGACTGGAATGGTTGACGCTTGACGCTTGCCCTTCGCCTTCCGCTGCATCTCCCCCCCCCCTGT
GTCGAGACCTCTGCCTGGGAAgcttcgtcgctgcttccactcTCAGGTTCGTGACACGGTGTACTACGCGGGCCTAGGACTCGTTATTGAACCAaaaact
cttcttcacctcaACCGCGGTCTCCAAGTCTTCGCGCACGAGGCACGAGCGGAATTGCTCAAAACAGTCATCAATTCAGGCGACTAGTTTGGGGACAGCT
TCGGGTCCTAATATAGTTTTTGTCTTTCGAAGAGAGAGTAAGAATCGACGAGTGCTGTCGACGAGATCCATTACGATCGACGGATACATCTCGTTCGCGA
GCAGTGACAGAACTTCTAGAGAAGCTGATATGTCTGCTCTCACCGTGGCAATTGGTGGGTCTGGAAGCTTGTTCTTCACCGAAAAGTCCGTCATATCATA
CAGCCGACGAAATTCGCGTTCTTCGCCCACGCCCATAGGGGAGAAATGCATCGAAGAGAGACCTCGAAACCCAAAATCCCAGTCGAAAAAtcctcgtgca
gctccagggTGTGACAAAAAATCGAACTCTTTCGCCTTCGACTGCATAGTTTCAACAAACAATTGCGAATCTAAAGCAACGTACTTACCATTGACCAGCA
GGCCGTGCGTCACCACTTGCTGTCGACTTGGTTTGAATTGCGCCTTCAGCTCGCGTCCTGCGGCCGCTATCAGTGCTGAAGTGTTGTTTGCTCCCAAGTT
GGCCTGTCGGAGTGCAATTAATTGGTCAATATCGCGAACCATGTCAGGATCGTCCCCAAGCCGTTGACGTAGGGCTCCAGGCCGTGACTCATCTCGTTCC
TTCGGTGGCGCCTCTCGCACCGCTTTCTACCCAATGCCTGTGCAGCCTCTACATGGCCCAAGTTGACAGAGTCACCGTCATCCTCCGAGTCGTAGAGCTC
CTCCaagcgttcttcttccgtccCGGCAATTCCTGGGCACTCCCGATCGTCGTTCGTTACCACAGCTTTGTCCGTAAATAGAGACGTTGGCACTGCGACG
CCTTAAGGAGGCCGGTGTTTGCCGTCATGGTAGAAGATAAAGTTCAGGATATGGCCGATTTTAAATTCTCCGCTCGAGTTTCCGCCATGTTATACATGGG
CACGCTTTGGTGCTCATCGACCTCCATCATACCTACCTTGCGAAGGACAGTGACGGAGCTCGGACGAGCAGGCTGCCCGATTCGATTGAAGTGGTCGTGG
ACCGCATTGTGCGCGGCTCGCATTTCTGCTGGCATCATAACGGCAACGCTTCGTCGCTGACAGTGGCGCAGTGCATAGGCCTCTAGAGCCAGGTCCAGCT
GCTCCTCTCTTCCATACGGCAGCTCGATATTTCCATCCGTGAAAGTGACTTGCAATACCCCTGTTTGAGAGGTCTTATCCCAAGTGTAGCCAACTGCCAT
GCCATAATCCCGGACCTTGGGTTGCCCTTGAGGCACCCTAGCAGTGCATAAGGCGCATCCAACGTAAGTACCAATCCCGCTaagagcttcctcctctGCC
ACCGCACGCGTCGCTACTTCTAAAACGTCCCGCTGTGTCGTGAACGGCCCAACATCGGTCCACCGACGACTCATCACACGGCCCTCTCTCTGGGCATCAG
AGACCGTCTTGCCGTAGGCGTAGCCTACTGTTTCAAGTATGTATGACTTAAAAACGCGTATTGAGCCTACATTACCAGGGTTCCTTTTGCTGAAAGTGCC
CGAAAGACTAAACAAAAGGTCGGATTGTGTTGAGGTTGTGGAGAAGCGGGGAAAAGGGAAAACTGAGGTCGGCCTAACGTCCAGCCTCCTTAACGAC