Description :
From Genome Similarity Track
Location :
Scaffold_1169:2548- 4431
Transcript NameFunction/comments
Phyta_totarag12275hypothetical protein
Phyta_totarag12276hypothetical protein

Sequence
1883 bases(100 bases per row)
GCGACACCTTGACCTCGCAAGCCTCCAAGTCGTACACTCTGTACCCTTTCGTGTTCTCAGCGTTGCCGTGGAACAtgcacttgaagctcttcGGCTCCAA
CTTCGTCCGTttggcatcgtcgacgtgaGCGTACNNNNNNNNNNNNNTGTTCACAAACTCAGTGCCGTTGTCCGAGCGCAGGCACTTAATTCGCTCTCCC
CACTGGCTCTCGTACGAGGTCTTGAACGACTGAAACATGTTGGGTActtcgctcttcttcttgaggaaTTACGCCACGACATACCTCGAGTAGTCATCCA
TCAAAGTGAGCACATATCTGGGCCCTCCcttcgacttcgtcttcatcggcCCCATGATATCCGTGTGCACCAGTTCCAACACacgcgtcgtcttcgtcag
cgaGCGAGACGGGAAGTGCGCAATCGTCTGCTTGCCCTTCATACAATTTCTGCACAGAGTCTTGACACTTTGATTGGCCAATGACATCCCAGTCGTCGCA
CACTGCGTTTTCACAAGCGCGTACCATTCCGGTGGCCCATGCGAGCGTGTCATATCTCTCACTCGCTTTCAACACACGAGTACTCCGTCATCACATCAAT
GTCCGTGTTAAGGCCCTTGTACGTTGAGGTTCGGCGTCATATGCGCTGTCGCACTACTGTCGATCAGCCATCCCACCGATCGATCATCTCCAACGGCGAA
GACCGCATCCGCGTCGGCATTGCCGTTTCCGTTCTTGTTCGAGCAGTCCCGCTACATGTGTCCGACTTGATCACAGTAGAAGCACTTGCCCTTGAAATCA
CGGTTTTTCTTCATGTCGTTGCCCTTGCTGCCGTAAATCTTGCCGCCCTTGCCTTTTTTTTCCAGTCTTGAACTTACCACCGTACGTGGTGGCCTTCAAC
GGGCGCTCAGTGACTTCCTTCTTTTCCAGCCGCTTATACTCCTTGAGGAGTTTCTCGTTCACCTCGATGAGCATTACGTCcttggcgttctccacgatcg
acgagatcaactcgTACTCCGTCGGCAGGCTGCTCAACAANCAGGTGCTTCGACATCGTTGCTCCGCCCTCCACTTGAACTCGTGGGGCTGACGGGCATG
GACACACGGCTGTGCATCGCGGTCCAGTTGTAGAACTCGCCCAGCGTCACCCATGCTTGGGGCCCTCGTCGCTGACCGAGTCTTGGTCTGGTGCTAGATC
TCCACACCTTGGACAATTATCCCGAGTGCGTTCGCGTCGCTTACGAGCCACGCCTCCGTGACTTCGTTTTCGGGCTTGACGACCTCCAGATGCGCGAACA
GTCCCTTGAGATCCAGCGCCATGCGCATGTTATACTCCCAGTGGAATTATTTCCCTCATCCGAGGAGGACTACAGTTTTCTTGGTCGTCATGGTGTTGGT
CCGCGCGGTCCGTATAGCTTGAGAGTCTTTTGCGATTGTTAACCTCTTGATCTTGAACTGTTGGTGTGGAAGGCAAATACCGAAGTGAGTATTATGAANC
GTTGACtagttttgaccaattagaTCACTCGGTTCCCcatatcaaccaatcaccaTAGAGTGTCTTAGCTAAACTCCAATCACTCCATATccaggaacgt
gctgcaTGTGGCACGTCCGATCCGGACTTCAGCCAAGCCTGTCTTAGAGTCACCAGGACATGAGTCCGCGTCGTCAGTCGTCTGCCGTGGCATGCATTGG
CAGCACTCCAGGTCGACGAGCGCTCGCCCAGGCCATTGCTGATGATTGCAACCGTCTGCATGGGCCGCAATCCACGAGCGCCGGAAAAGATGAAGACAGC
ATTGAAGACGGTGTTCAGGAATGAGAGGATGACGAGCAAGGTGAGCAGGAGGGGGACAAAAACGAGAAGTATGACGACAAACA