Description :
From Genome Similarity Track
Location :
Scaffold_8:254796- 256422
Transcript NameFunction/comments
g3386.t1hypothetical protein

Sequence
1626 bases(100 bases per row)
CTGGTGGTGCTGATTTCGGCTGCGTCTTCGTCGTTTGTGGTGGAGTTCTTGTGTTTCTTGGCCTCCTGCTTGGCGCGTTGCTCCTTGCGACGTCGCAACA
TCCACTCGTACGTGCCGTAGCCCAGCAGCATGAGGTACAGGTGGAAACCCAGCAGGACGAAGTACATGAACATGCATGGCACGGAGATGGCCAAGCACAT
GATCAAGCAGATTTCCACGATGTACCCGGACGTGCCAGCGTCGTCCAGCGGGTGGTAATGCAGCCACAGCAGACACAACGCCGCGTACACGACCTGCAGC
ACGAACTGCACCGTGCCCGTGCACGCGACCGTGAAGAACTGGGCGTAATTGGCCTTGCCGATGCAAGTCTGCAGCCACGTGCAGTGGTGGTCCAGTCCGG
GCACGGCCTTCCGACACAGCGCACAGTACCGAGTCTTGTCCCACCTGGGGCCGTTGAGTCTCACCCCACACCAGCCATTAGGCAGCGAGTCCTCCACGGC
CGCCGCCGGGTCAATGGTCTCACAGGATCTCCAGGAAGTTACCAGCAAAATTGAGTTCACCACATGCACCGCCACCGCCACGAGCGTCTGCAGGACACCA
CCCAGAAATTGACATTAGCACATTTACGGTAGAACAATGGCAGAACTCTACCGACCATTGTGGTGATTGTACTATTGGTGTTTTCCTCCTCCACGCCGCC
CCGCCCCGTGCACAGGTAGATTCCAGCCGCTCCAATGAAGAAGCACAACGCGGAGAGCGAGTGGCCAATCCAGGAGATCACCTGGTCGCGCGAGAACGGC
CGCTCCAAGCCATTGTGTCGCTGGGGGCCCAACACGCTGGCGGGCGCGTCGTCTGCGCGCGGCGACTGCTCCATGGACTCGGAAGGTGCAGGAATGCCAC
TCGAAGCGATGACCAGGAAAACTATTTGCGGCGAGATAAAGATAAAAATCCACCGAGAAAGGTGAAAATAACTTGAGTTGAGTATGGAGTGGAGTGTACC
CATATTGACAGGATCTGATATTTTTTTGAACGGATAGGTTGTTGTGAAATTGGTCACATCAGCGGAGGTCGAGTTTCATCAGCGAAGTGGTCTGTGGCAC
CATTTGACCTCGTTTAGAATTTGATCTACTGAATGTATCACATGGCAGATTTCTTGCCCAATTGATGTCCTGGTTAGAGCTTATCGAGCGTGGAGCTGGT
GGCTTCCATCCCCGTGAAACGATTTGGCAACGGCTGATAGAAATGTTTTGTCGAGTTTGGGCTTGTTGTTGGAATCGCTGGCTCCGAATTGTTCTACCGC
TGTTTGTTTTTCCTGATCAGAAAGTTGTTAGTTACTTCGTTCAGATATTCCAAGTAAGGTTTTGTGCTGCTAGCTTACTCCACGTATGGTGTCCGGGTGA
AGCTGCGACTGAATAACATCCGTGCGAACCAGCTCCAGCGTTCGCCAGCACTCAAACCCACGCAAATTTTCGACGACTATGCAATTAGGATACCACCTTA
ACGACTGCAAAATTGAGAATGGTGTCACCTCAGTGTGATACTTTGCGAAGAAAAGTTCCGTAAAACAGCGGATTTATACAACACCAAGCTTGACAAGCTG
GAGATAAATCATCGAACTGGTCGATG