Description :
From Genome Similarity Track
Location :
Scaffold_128:25478- 26864
Sequence
1386 bases(100 bases per row)
ATGCGAAAGTACAAGCAATCGGTGCCCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACTATGAACATGTTGGATGATGAAGCGGATGAATTCC
ATCAAACGCACGAGAGCTACTCCCATTTGAGTCAAACCGAGTGGGATGCCGTCGAACGTTTGAGCTCGACAATATGGCAAGAAGCCGTAGGCGCAATGCT
GTCCGCTCTTGTTCCAGACAGGCAACACGGGGCACCATCGCCAAGTTCATTCCGAATGAACTTGACGCTGAACAGAAAAAGGTAGCCTTACTTCACCACC
AAGGATCTCAACAGACAGAGCTGTTAAAACGGCAACAGGCTGCTGCTACCGGTTCGACACATACACGTCGACCCGAATCGTTGAAGATTGACATCTCCAA
ATATAAAGCAGCCGATGAAGACTCTCTGCTGAGATGGTTCGTCGAACTAGATGACGCCATAAGGGCTCATCACATTGTCGATGAGCAAATACAGGTCGCA
TTTGCTCAATCGAACTTGGCAGGACGTACGAAGATTTGGGCCTTGGGCCTCAAGCTACACGACCCTTATGTGGGTCGCTAGCAGTCTTCAAGTCCCTACT
TAGGCAAGCATTCGAGCCGCCGCGAGCTGAGTTCAGGGCTCGCTCTGAACGCCTGAAACTCAAACAAGGCAAACGTGAGGTACACTCGTACATTCAGTAT
ATACGTCATCTTACGAGTTGCATCACGGCCAATCCGCCGAATGAACAAACGTTGATCACGTTGTTCATGCAGGGTCCCACAGACGGTCCAGTCAGGACCT
ATCTCTCCAGATTGGAGTTTGATACCCTGGAAGAGGCACTCCGAATTGCGGAAGAAGAAGATTTCAGCGTGAAGCAAGCTCATGTGAGTTTGAATTCCTA
TCGTCCCCCGAAGCGACAGGAAAGCGGAGGCCCAGAACCGATGGACCTCTGTTACGCTGAGAGTGTAAGCTCTCGAGTTACCAACATGAGAAATTGCAGA
CATGCAATAGGTGTCAAAAGACAGAGCATTATGCACATGAATGCAGTGCTTCGAACGCGGTACCACGTACCGCGTTCGTGGTATCGCGTTTGGGGCAATA
AAGGTCCGAAGCGAGGGTCCGACCCTTTGGCGAAAACGCAACGCCAGGACGGACGACCAAAATACGCGTCAAGGTAAGTAGGTGCGAAGCACTCTACTGA
TACAGCAACTTCAAGTGAATTTGCAGGCCTCATTAACGAGAATTTGCTCCCAACACGCAATTATTGTGTGTTACTACATCTGGGGTATTGAGGTTTCCCT
CAGTACCTTGAAACTCGAAGTGGCAAAGGACATGTCACTTCGTGCTCTAATCGATTGTGGGGCGTCGAACACTTTGTACATCGGCA