Description :
From Genome Similarity Track
Location :
Scaffold_218:25468- 26593
Transcript NameFunction/comments
Phyag_g3612predicted protein

Sequence
1125 bases(100 bases per row)
CCGACCTCAGTGATTCCATCTCCTCCGCAAGGTGGACGGGGCTTCCTGCCACGGGGTCAGTATTCAATGACGGTCAGGTGAAGATCGCTTTCTACACCGG
CGGAAACTGCACAGGCAAAGCGGTAGTGGTGAACACGATCAAAGGGGAGGTTCGCAACTTTGCGGACTTCAGAACTGACAACGCCACCGCTTCGTTTGCG
ATTTTGGAGAATTCGACGGCGATGAAGCATGCCACGGCCAACGTTTGCCAGTGGTAATGGGTGTTTTTGCTAGCATCAAAGCTGCCAATGCAGTAAGATT
TCGCTAGGATCGAGTTCCAACTGCAAACATGTCATTCAATTTGATCGCGCTACATCTTTTGCAACACACTCTACATTGTTCTCATCAACAAGTATCGTGC
TGGTGGGTAGTGACACTGGCTCAGTTAGACGGATGTGCGAGTGCTTGGCGACGCCTGATATTCATTTCCCGCTTACGAGAGTACGCGGTCGATTTCTCAT
AATCCATGTagcgcgctgcagcaatgaAAGGTTTCATCCGTGGCCGACGCGTAGGggtcgtcttcttgtgtGGGGTCTTCTGCGCTGCAACGACTTGTGT
AGAGCGCTGTTGGGCTTCATTTGTTTCAGCACGGAGAATATGACACGACATGGCTGCAGTCTTAGTTGGTTTTGCCTGAGCGGCTGTAAAGCGCGGTGTC
CAACGCAGTGTACTACCCATATTCCTCTCATCGTGGCGGCGAGCTGCTAGCTCTAATCGATCCGCCACGTATGCGATGAAGTGTGCGGTCGTTAGAAGGC
GAACACCAAACATTGGTGACTGGACAAGTCGAATACGATGCAGCGAGTGGAGCGCACGAGTGGAGTGGTGGTCGACGGTGGAAAACGCCCACACTGCTCG
CGTCcgctgaaggtgaaggtTGGAAGGGCAGGTTGTGGTTGCTAAAATGAGGCACACCTCGACGCCATAAATCCTGGCGATTAATTGCACGCGACTGGGT
GTTGGCTGAGAGTTTGGTGAATGTATAATTCCCCattcgtcatcatcgtcagcgggggctgcttcgtcttcgtctaGATTGCACTTAGTGACAAAGGGTG
TGGCAGACCTGATGCATGTAATGCT