Description :
From Genome Similarity Track
Location :
Scaffold_92:25454- 26910
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_92-fgenesh-gene-0.11Pseudouridylate synthase

Sequence
1456 bases(100 bases per row)
CTCCTCCTTCTCCTTCTTCCACGCGGCGTACGACTTGGCGACGTAGTCGAACGGCAGCGTCTCGAGCGTACGCAGCCACTTGGCGTACGTGCGCGTGGCC
TCTTCGTGCTTGATGATGTGGTCAAAGATGTGGTCGCGCTTGAACTGCTCCACGGCGGCGGCCACGCGCTCGTCCTCCAGGTCCAAAGGTGGGTGCGAGG
TCTGAATCGAGTCCTTCATCTTGAGGTTGTAGATCTTGAAGTGCGCCTGCGCGAGGTAGAGGCCGACGCTCGGCGCCTTGGGCAGGTCCATCTTGTCCAG
CTGCGTCGCTCGGTCGATAATCCCAATGTCCGTGAGCCCCGCGACGACCTCCACGGCCGCGCCGATCATCTTGCGGATGTGGTGCAGCAGGAAGCTCTGG
CCGATCACGCGCAGCCGAATCCACTCCATGTTGTTCTCGACAAAGGGCTTCTCGGCCGCAAACGACGTGATGTAGCGGTTGCACTTGGGACTCGTGGGCT
CGAGCTTGGACGTGAAATTGTGGAAGTTGTGCGTGCCTTCGTACTGGCGCAGCACCTTGTTGAGCAGCGCGTGGGTCTCGTCATCCATGCGGAACTCCTG
GTGCTGCTTGAGTGTCTCAGGCGTGATCTCGATCTCCGTGTTGATTTCCTCCTCCGCGTCATGCAGGTTCGTCGGCCACTCGCCACTGGAAGGCGGTGGG
TTGGCGGTAGAACGGCTGCGCTTCCCAAAAATGAACGTCGGCGCCAGGTACTCGTACGTGCGCTGATCGCAGGCCAGCTTCGCATTAAAGTTCTTGGTGA
CCGTGATCATGTGCATCACGCGAATGTCTTCAGGTAGCGCGGCGTTGACCTTTGCCATGAACGCTGGGATATCGTCACCAACCTGTAGCTTCGCAGTCAG
TAGCTGGCCGGCGGCATGGACTCCCTTGTCGGTACGTGCGGCGCGACTCCAGCCGACCTTCTGCAGGAAGCCATAGTTCACTTCAGCGATTCCTCCCGCC
TCGAAGAGCGCGCGCTCCACCTCCGCCTCGATGGTCTTCACGCCTTCGTTCCTATTGCGCAATGCCATCATCCACTCGTCATCAGCACCATAGCCCAACA
CCGATGCAGGACCAATTGCCATGTCAATCATAGTGCACGTACATTTGCATGCCGGAGTAGTTCTTGCCGCAGAACGCAAGCCAGATGCCGTAGCGGCGCT
TCACCACTTTATCTTCAGTGCTCGCGGCGTCTTCCGCGGATGCAGCAGCACCCTCGCCCTTGGCGGCGAGCTCCGCCTTGCGAACAGCCGCGTACGAGCC
CGGATGGATGGCCTCGGAGAGGCCCGCGCGGCGGTCCACGCCCTCGTTCTTGCGGCCGCGCTCCTTGCGCTCGCCATCGTCGTTGTCGCCATCTCCGTCT
TCGCCAGTCCGCGCCTGCTTGTTCTTGCGGCGCACGGCCCAGTGCGTCTTGCGCTT