Description :
From Genome Similarity Track
Location :
contig_30:25453- 27018
Transcript NameFunction/comments
g6499.t1ETI38474.1 hypothetical protein F443_15812 [Phytophthora parasitica P1569

Sequence
1565 bases(100 bases per row)
GGCAGTCTGCGCCCACCCAATGGTTCCGTGTCCGCGTATAGCTGGGAAAACCTGGGCATGCTCACCCACATTGCAGCTGTTGGCGTCGTCTACGGCACCG
TGAGCGGAGTCATCTACTCGGTGCTCAACAACTACCTGCACATGTCCACCACGTTGGTTGCGACGGCGACGGCACTTGTGACGTTCCCACGCGCGCTTCG
CTTATTCACGGGCATGCTGGCCGACACTTGTCCAATCTTCGGCTACCGCCGCCGGCCGTACATGATCATCGGCTGGTCGCTGTCGTTCATCTCATGCCTG
CTCATGGCTGCGTTGCCGCTCGGCGAACCTTACTACACGGATGCGTCGTTATCGGACATCGCCACCGTTGACATGACGCCAGAGCAACTGGCTACGCTGA
ACACGGACGCTCCGAACCACGGCATCAAGCTGATTATTCTCATGATGATCGCTAATTTCGGCACGGTGATGGCGTACAGCGGCTTCAACGGGGCACTGAT
GGACGTCTCGCAGCGCGAACCGGAGGCCTCACGCGGCTCCGTAATTGCTGATGTCAACATCGTTCACTACGTTTTCACAATTTTCTCGTCCTTCATGACG
GGTATTGGCCTGAACAGTGAAGACTACGGCGGCACGTTCTCGTGGACTATGGGTTTCAATGCTATCATGTGGATCTGTGCTGCGGCATCGCTCCTTACCA
TTCCGTTTTCATGGTACTGCATCCAAGAGGTGAAGGGTGAACGCGCGCAGATGTCAGGCTTCAAATTCTTGTACAATATTTTCCAGGAGCGTCTGATCTA
TCGCTACGCTGCCTACCGCTTCTTCTACAACGTTTGCTCTCAGATCACTGTGACAGCGTCGAGTGTGATTCAAAGCGACTGGGCGAATGTGGAGCCGCTG
AACTCGGGCATCGCTAGTATGCTCACGGCAATTCTGACGATGGGTGGCGTGTACCTGATCAAGAACCGAGGTCTGCACTGGAATTGGCGGTACATTATCG
CCTTCTGCCAAATTTGTGTCGTGGTCATCGACGCTTTTCCGACGCTGTTCACGATTTGGGACGTGTATCGCAGCCAGTGGTTTTGGTTGGGCGTACCGCT
AGTGGCGGAGCTTCCCGCTGCAGCGGGTGACTATGTGACTCAGCTATTCATGATTGAAATCGAGAACCAGAAGGGATTCGAGGCTACGCTTCTCGGACTT
GGCGTCACAACGCAATCTGTCGGTACTCCTTTCGCGACCGTGATTACAAAGTCTGTGGACGGGTACTTTGACATTGGCCGCACCTTCATCGAGCAAGACA
ACCACTACGTTCGGTCGCAGGTCACGTACACGTATATTATCGCGTACGCGTTCAATATTATCTCGGTGGTATTCGTACTGTGGCTGCCGAAGCAGAAGGA
GGAGGTTCACAAGATGCAGCGAGAGAACCGCAAGAGCAAGTTCTGGGGTATTGTGACCATCAGCTATCTCATCTTCTCGTTGGCGTGGACTCTGATGACC
AATATCCTCAGTCTGTTCGACTCGACGAGCTGCTTGCGCATCGCTGGTGGCAGTGGGTGCTGATC