Description :
From Genome Similarity Track
Location :
contig_120:25452- 27001
Transcript NameFunction/comments
g11369.t1hypothetical protein PHYSODRAFT_261658

Sequence
1549 bases(100 bases per row)
TAGTTAGTGCTGTTGTTGCGGATGTAGTATGGCTGGTCCTGGAACTCCGCCTCGCAGTACGAAAACAGTGTATCGTCGTCCGATGGCGTGAAGAGCTGCT
TACCGGCGTGGATCATCACGTAGCAACCAGTGACCGCGCATACTAGGATCACCAGCATCGATGCACCCTTGTCCAGGATTGACATGCTCTTCCAGAACAC
GCGCAGGTAAATGATCAGCGGCATGAGCAGGCAGCTCGTTGTGTGGCAGTGGCGCCCGTGAAGTCCTCCAGGTCCAGGAAACGCTTGCGCGCCAGCACGG
CGATGATCACCAGAATCACAATGATGCAAATGCGCAGGGCGATGTAGCGCAGCGGGTTGTTGCGGTACGGCTCGTGCAGCTGCTCCGCCGTGATCTCATC
GCCGAACTCGAGCGCCACGCGCAGGTGCGACATACGGCCCTCCGACTTCTCGACCAAGCTCGAAGCAGACACCTGGCGGTTGGCCGTGTCCATGGGCGTC
GAGCTCTGGATGTACGAGCGCTTCTCCTGGATCTCCAGGTCAAGGTCCACGTTCGCCTGGTCCGCCTCACCGTTGAAGCGCACGATCTCGGGGCCCTTGT
GCATACCCAGAATGAGGCGCTCCGCCATGTAGAACGGCGGCATCATGAGCGTCGAGAAAGCGATCGAGATGTGCACCTGCATGAACAGGTACGACATCAC
CACAGCACCGCGGTCGGCACTGAAGCCCAAAGGCGCCAGGCCAAGCGGGTCTGACGTGCTCACGATCGAGTACAGGATGTTGCCCGAAAGCTGGGCAGCC
ACCGGCCGTGTAACCAGCCAGAGCAACAGCGATGAAGAAGGCCGAGATGAACAGAATGGTGATCACCACCACACGCGGCATGCGCTGCGGCTGCGAGTGC
TCACGCTGCAGATCGGGCACGACAATGGCAGCACCGTACGCCAAAGCAAGGTTACCGAAGCACGTCAGCACTTGGTGCAGCGTCACGTCTGGCGACGGGA
TCGAACCGTGGCCGCGCATGTTCCACTGCAACACCGACACGGCGATGATGTCGGCGATGACCGTGCCCATGCAACCGGCGAACGCCATGCCTGCGCTCTC
CTTCAGCGTCGGGATTAGACAAACTGGGATGACCATGAGCGCCATGAAGATGATCCAGAAGATCTGGCTGAACGAATCCGGGAACAGCACGTCCAGCAGA
GTGCTGCCCAGCACCAGGAAGGCGATCGGCACCAGCAGACAGACGCCCATCTGAGAGACGACCGTGAAGAAGCGGCCCCACTTGCCCAGGGCCCACTCGC
CTAGGTCACCGTACGTCTTGACGGACGACGGCGCCACCAGCATCACCTTGGAGAGCTTGAGCGTAGCGTACGTGTTGGCGAAGATCATGAAGGCCAGCGC
GATAGACGCATACAACGGGCCGGCGCGAGCGTAGTTGGAAGGCATGGCCAGCGAACCGATACCGCACACGCAGCAGAAGAGGTTGAAGGACGCCTTGGCG
TCCTCCATCGTGAAGAAGGCAGTCTTGCCGTTGGCGGCCGACATCGTGG