Description :
From Genome Similarity Track
Location :
Scaffold_29:25450- 27043
Transcript NameFunction/comments
Albla_Nc14031680conserved hypothetical protein

Sequence
1593 bases(100 bases per row)
TCAATGAATATGTTTGCATACTTTACACTCTTTGTTCCAAACCTGTCGAGTATGTGCGACAAAAGATGGACAATTGCATAGTCGACACGCTCCCATGATG
CTTGCCCTAAGAAGGACTTGTTCCCGATGAGTTGTGATACTTTGTGTCGCCTTGTTGAGCGCTTCGTACAGAGGAGCTGCTGCAGTCGGTTGTTCAACAT
AACCACTGAGAATTTGCTGCGGCTGCAGTTCTTGTCCGTAAAATTTGCGATTGATATCGGTGCGGCTCGCAATGACAGCTCCTTGTAAGGAGATTCCAGC
ATACAATCCTTTGCTCATTGAGTAGCTATAATTTGTATTCAGACCGCTCTTACTGGCGGAAGCTACCGCCTCTGCTGATCGCCCAAACGGACCCACTGCT
AGATCCAAGCCACCTCCAAGATTGATTTGCGGCTTGTGGAATACCTTTACAGCGCTTTCTGAGCCCAATATGATCATAACTTCGACAATTTCTCCGCCTA
TCTCCAGACCACCTCCTAAGCCGATCGTTCCAATCGCGGAAGGTGCAGACCAGGATCCGTCCGGTAGTTTGGCAATCACCAAACCTGTTCCAATCTTGCC
AGTGACGAGAAATCCTGCCTTTATAATGGTCATGAGCGCTATTCCATGAGCTTTTTCTAAGAACGCGATTGGTATCGATCGATCTGCTGAGGTTCCCCAT
TCATTCCGAAAAAAGTTGCCAATGATATCAGCCGCATTTTGACACTCTTTCACGAGACTACTGCTGTAAGGAGCATGAAATCGACCACGGGCTTCATGCA
GGTTCTCCGTGTTGGAAATGGCATATTTACGGATTAGTTCTTCTTGAAGGGGCTGTAGTTGTGGAGTACATTGGATACACGTACGTTGTGGTATTGTTGG
GTCGTATCCTTTGGCATTTTCAAATTGTTTGCCTGGTGGAATGAGAAACCGAACAGGAGAGCAATTATTGCACACAAATTTCCCGCAGTATCGACTACAG
GCAATATAAGTATCATTGATACAACGTAATGTGTCTAACGTACCACTGATGTCTTCGTTTTGTCACATCGAATCCTACTTTGCATATATCACAATTCGGG
TGGTCGGCGTATCGGTTTTTGAGCACGCCTTTCGATGGTCTACCACAAGCCTTTGAGATATGAGGTACAAGGAGCTTCTCATGCAAACGTACCCACTTTG
TCCAGCAACAACCATTGCGCGTTCTGAGGCAGCTGGCACTGGAAACGGCGAAGCCGACCCAGCCATATTATCTGCACGAAACGTATCAAATTGTGTCATT
TCACCTTGATCTACCATTTGATCATTGAACTGAACTAACTCCCGACGTCTTGTTTGATCAGGGACTAATCTCGCCAATAGCGGAATAAACTCAATCGTTT
TGTGAGGCCCTAGTTCTTGCACGATACTTGAATGGAAATCAGACACACTCATGAACCCTGAGCCATAGTTTTTGCAGTTTTTCTTGAACATTCGAACTCC
ATTTTCATTGTTATGCTGCCCGTTAGCATTCCGTATCGTATTCACACAGTCTTCGTAGCATCTTTGCGCCTCGACACCGGTGGCGGCCGACGG