Description :
From Genome Similarity Track
Location :
Scaffold_77:25447- 28496
Transcript NameFunction/comments
Physo_139663reverse transcriptase

Sequence
3049 bases(100 bases per row)
TGCTTCTGGATCCGATAACGCCACCGTCAAAGATCCCGATCCCGAGTCCGGGTACTACCCAAAGGTATCGTTGCCTCGAGCGTCGATCGAGGATCCCATC
CATGCACCAGATAAAAAGGGGAGTCCCCACGGACCCGATCCTGAGCCGTGTTGATCGCGAAGGTCAATCGCTCTGCGTACTCATCCCAATCCCTCTGATC
CAGATCCTCCACGAACATCTTCAGGGCTCTCGTCGCCGTCTGTACCATTCGCTCTGCAGTACCGTTAGCCTGAGGTCGATATGCCATCGTCGCTCGCTGG
CGCATACCCAGGATCTTGTCAAAGGCGCGGAAGAAGTCAGCCATAAATCCCGGCTCTCGATCGTGCCTGATCACCTCGCTAGCACCAAATCGCCGGAACA
CACACTCTTTGTAAGATTCGGCGATCATCTGCGCCGTTCGGGAGGAACTGGCCTTCGCGATCACGTATCCCGTGAACAGATCGACCCAGATCAACAGTTC
CGTTTTACCCTTGTACGACTTGGGTAGCGAAGGTATGTGATCCATCGCTATGATCTGGAACGGGTATGTCGCCTGGATGTTTCCCGGCGACTCGCCCCTG
ATCGTGGGTCGTCCTTTGCCGGTCTCGCAGTCGACACATTCGCCAACGTACTTCTGCACACTTCTGAAGAGACCTCTCCAGTGAAAGTGATCGCAGATCC
GCTGATAGGTACACCCGATCCCCTGGTGTCCCCCTTCCAAAGTGGAGTGATAGTGAGTGCAAGATATCTTGATGGAGCGTCTCTGGTGCAACCAGCCTCA
TCAGACCATCTCGATCTGCCTCCGATCGTTTGGAGGGCGGGCAATAGAACAGCAGATTATCACCGTCGATCTCATAATCCGCTGCGATGTTGCCATAGGA
TCGAGCCTCATCCTGCGTCAGTTCAGCCACATCTCCCATCAGGTACTTCTTCATACCCGCGATCCACGTTTCTTCATCTTGAGCTCGACGAATTCGGTCG
ATCCACAACCCTCGCACGAACTCCTCTTGCATGACGGTCGGGTTCGGCCGTGATCTGGCGCCCGATCGGGTGGTCATCGGCGATAGTCGGGCGATCGACT
CATCCGATCGAACAACCAGGATCTCATCAAGTCGGTTCAGTGTCACTAAATCCCCATGATCGACCTCATCCTCGACGACGACGCCCCCTTCACGTTGGAG
TGCTGCACTGGCCAGGCTGTCTGCACTCCCGTTCCAGTCTCGTTTCACATGTAACAGCTCGTGATCTGGCCAGTTCCGTAGTTGGTCCAGCACCTTCTGC
TTCAACAATGTCAGCTTAGGTGCTTTGCAGTCGATCTCGCCCCGTACTTGTCGGATCACCAGGTTGGAATCGCCGCAGACCACTAACCTGCCTCGATCTA
TGCCGTCAAGGAGGTCGAAACCCAACAACAGACCATGATACTCCGCCTCGTTAACCGTCAGCCCTTCAGCATAGCCCGATCGTGCCTTCACCACGCTCCA
TTCGGGTATTTTCCACAAGATCGCGCTGTACGCGCCCCCGCCTCGCTTGACGCGGGCGGATCCATCGAAACTTATCACCAGCAGCTCTTCGTCCGCACGC
ACAGTCGGGATCGGGGCCTGAATCTTCTGCCGGGGTTCTTTCTTCGGCGCGATCGCGATCAACCCGTCGTCCATATCCGATCGAGGCGTAATACTAGCGG
TGATCACCCCCAATATCTCGTCCTCTCCCTTGGTGCACTTCGTGGTCTCCAGTGTCCAGGGCGATAGGAGTGCAGCCCACTGACCCAATCGGCCTTGAAG
ACCGGGTGATCGGAACAGCCACGCCGACGTCGAGTGTCGGGTCAAGACCCGGATCGATCGTCCAACCTGCATGTTATAGTTTAGGTCCAGGATCCGTAAC
AGCGCCAGTACTTCTTTCTCCACAACGTTGTAGTTCAATTCATTCGACTTCAGCGTTCGACTGGCGAAGGTAACGGGATGGTAGATCTGGTCGTGCTCCT
GCATCAATGCGACCGAGATCGCCCAGTCACTCGCAAACACAATAACGACCGGAGTCCGATCGCGATCGAAATGCCGCAGGATCGGCGTCGTCGCGATCTT
CGTCTTCAGTGTCGCAAAGGCACGATAAGCACGGGTTCAGCGTTCATCGGCAACACCGACTTCAGGAACGGATGGAGTCCGATTCGGGCTCACTGGTTCC
GTATCCATTCAGGATCTGGCGCAGATCGGGGCGCTTCTTCAGCTCAGCGAAGTCCACCTCGCGCAGTTCGTACAGGATCGCCGCGTAGATCGCGTAATCT
TCCAAGAAACGGCTGTAGTAGTTGAGACTGCCCAAGAATGACTGCATCGATCGGAGCGATCCGGGGAACGGCAGAGCAGTCAGGGCAGTGAGATCCTTCA
GATTGGCCTCCAGCCCATCGTTCGACACACGATGTCCCAGATAGTCCACCTCACGCATCCCCCAAGAGCTCTTCTCCACACTGATCGAGAGGTTCCACTT
ATCACAAGCGTCCAGCAGGTGGTCAACGCGATCACACAGCTCGTCCCATGACCCGGCCGTCACAAGAATGTCATCAATGTACGATCTGCGACCTAGCACT
GATGGACGCTCCGGATCTTCTGGTTCTCCTGACTCGATCAAATCCGTAGTGACTTCACAGTCCGACGATCACGGGATCCTGGTGAACCCATACAACGCGT
CGTCCAGAAGTCGCTGATAGATCTGAGGAGGGTTCTTCAGGCCGAACGGCCATGTGGGTGATAAAGGCCGAGATCGCACGAGCTCGATCGGTCATTGTCA
CTACCCAAAATCCACTCGCCATGTCCAAAGAGCAATACCAGAGTACCTTGTCCAGATCTTCCAGCAGAGCGTTGATCAAGGGCATCGGATACACCATCAG
CCTGGTTAGACTGTTGACGAGCCGATAGTCGATACAGAGTCGGATACCCACGCCGTTCTTCTTGATGATCACGCCAATCGGCGAGGCCCACGGTGATCGA
GATTTCCGAATCATCTTGGCTGACAATAATTCCTTGATCAGCTCAGACA