Description :
From Genome Similarity Track
Location :
Scaffold_89:254436- 256041
Transcript NameFunction/comments
Aphas_H257_16082Hypothetical protein

Sequence
1605 bases(100 bases per row)
TAGCTGCACAAAGTTTTCAACAAAGAACCCAACGATTTCCGTGCCAATCGAGTGGAATAACGCCCCCAGTAGGGCAGCGTTGACCGTGATCAACTGCGTC
ATCACTTGGGTCTACATGTATACACCGTTAGCAGTCTGTGATGGGCTAGAGGTGGCAGGCACCTCATGGCAGCACGTTGCCAGCAGGGTCTCTAGCAACA
CTCGGTTCACATCAGCCCGCACGTGCGCCCGATAAATGGACTCAAACTCCATCGCAATGGACCTACAGCAATCAAACCGGTTAACTGCATGCCCCCAAGC
GATAACCTTTTTGTACTCCATGTTGCTTTCTGCCAAGCGATTGAGCTGGCCGTTCACACGTCGACGGATCTCCCGCAGCAAATTCTCGTTGCTGGTGGAA
GCCACACGCAAATGCGGCGGCACGTAACGACTGGCTTCGCTTGAACCTAAGACACGATGAATACACGAGAGGCATACTGGCGTACGTATACCGGATGGGG
CCATCTTGGGTCGACCATAGATGTCTTCCTCAATTTCTAACCCAGATTGTTGTCAAAACCATTATTGTATTGCAGCTAGATTGTACTCAAATCGGTTGGC
TTGCTGTTGGTATCATCATCGTCGATGCTGTCGTCTATGGCGATCCAATGAATATTACACAACCAACGGATCAAAGTACCTTGTTCCACTGTGGTTTGGC
TATTCGACTTGGTGTTTCGAGCCACGTCTTCGTCTTCGTCATCACTCATGTCCTCGTCGTCGCTTTCGTACTGCGCCAAGTCATCGACTTCGTCTTCGTC
GTCCGTGGGCAAGTCGTCAAAGCCTGCGCGCCACCATAAGTCAGGGGAGTTATTATACCGCCAGCCACTACCTTGCAAAAACCCGGCATCTTCGGTCGCC
AACATGTTGATCTCGTCCTGCAAGTCTTGGTCGTCGCCGCTTCCGTCGTCGCCGCTGTCAAACGAGTCGTCACCAGACTCGGAGTGATCGCTGCCCTGGA
TCTTTCTACGTTGCAACGTTAGTTCATAACGTGGTGAAAGCGTCTGTGCGCTGGTTTACTTCGACAGATCGTCCAAACTCGTGAGAAAGTCGGCGAAGTC
GGTGCCGAGTCCGTCGTTTTCAAATTCCCTGTGCAGATGATCATAAGCTGTGGCTCAATGAAATCTCCACGTACTTGTTCAGCTTGGTTCTGCCGTTCGT
CTTGGAAATGCCCAAGTTTGCTTCCAACTTCTTCAAGGCGTCGTCCTCTGCAGATCGCAGCTTCTTCACTCCAGCGCCTTTTTTGGTAGTCGTTGACAAA
CTTATCATTCCTGAATCATCAGCGTTAGGTGCACACATTATTATTGACGATATGATCACCATCATCAGCCTGAGCTTGGATCATTTCCATGAACTTGTTC
TGAATTCCCACGCGCGGTCGCTTGGCAGGGTCGGTGCTACTCGGTGGGGCTTTTCTCTTGCCCTTGAAGGCTGCAACCTGACTATTTGCTTTGGCATGTG
TGGCTGGCACGCTTTTCTTCTGTTGTGCTCGACTGTTCTTATGCTGCTTCTTGTCTTGACGCTCTTGTTGACGCCGCTGCTTCCGTTGGTTGACCACTTT
CATGG